Incidental Mutation 'R7845:Ptx4'
ID606583
Institutional Source Beutler Lab
Gene Symbol Ptx4
Ensembl Gene ENSMUSG00000044172
Gene Namepentraxin 4
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.457) question?
Stock #R7845 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location25120760-25125268 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 25124954 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 393 (Y393H)
Ref Sequence ENSEMBL: ENSMUSP00000055984 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054930]
Predicted Effect possibly damaging
Transcript: ENSMUST00000054930
AA Change: Y393H

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000055984
Gene: ENSMUSG00000044172
AA Change: Y393H

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Blast:HOX 32 122 3e-35 BLAST
coiled coil region 147 182 N/A INTRINSIC
Pfam:Pentaxin 271 460 7.3e-33 PFAM
Pfam:Laminin_G_3 277 440 2.4e-14 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 96% (43/45)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the pentraxin superfamily, whose members encode highly conserved multifunctional proteins. The encoded protein, like other members of this family, contains a conserved pentraxin domain at the C-terminus. The highest levels of expression of the protein were observed in bone marrow, small intestine and testes. [provided by RefSeq, Jun 2016]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921509C19Rik T C 2: 151,472,309 H483R probably damaging Het
A430078G23Rik T C 8: 3,386,959 Y250H probably damaging Het
Acot2 G T 12: 83,992,988 G424* probably null Het
Adat2 G T 10: 13,552,997 probably benign Het
Bcl2l2 A G 14: 54,884,851 Y157C unknown Het
Bglap2 T A 3: 88,378,694 probably benign Het
Ccdc14 T C 16: 34,715,364 L495P probably damaging Het
Cobl T C 11: 12,365,139 D275G probably benign Het
Cpne2 A G 8: 94,551,204 N72S probably benign Het
D7Ertd443e A G 7: 134,270,248 F628S probably damaging Het
Dars2 A T 1: 161,041,748 S644T probably benign Het
Depdc5 A G 5: 32,903,915 probably null Het
Dip2c A G 13: 9,609,044 S860G probably damaging Het
Dnajc21 T G 15: 10,447,141 H507P probably damaging Het
Eif2ak2 G T 17: 78,863,898 Q359K probably damaging Het
Epha8 T C 4: 136,936,401 E448G probably benign Het
Exoc3l G C 8: 105,290,150 S677R probably damaging Het
Fads1 T A 19: 10,194,041 H345Q probably damaging Het
Fam118a T A 15: 85,045,851 D93E possibly damaging Het
Fam135a T C 1: 24,029,657 I710M probably benign Het
Fbxw14 T A 9: 109,287,603 I13F probably damaging Het
Gemin6 A G 17: 80,225,661 S8G probably benign Het
Ints2 A T 11: 86,238,263 M498K possibly damaging Het
Man2a2 G C 7: 80,368,865 A82G probably benign Het
Mast1 C A 8: 84,925,325 E343* probably null Het
Micu1 T C 10: 59,839,785 probably null Het
Mis18bp1 A G 12: 65,149,328 I554T probably benign Het
Mrps28 T A 3: 8,923,715 N28Y possibly damaging Het
Mtpap T A 18: 4,387,134 S395T possibly damaging Het
Muc16 A T 9: 18,640,773 H4741Q probably benign Het
Ogfr GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG 2: 180,595,266 probably benign Het
Olfr1294 C A 2: 111,538,167 G41* probably null Het
Olfr1340 T C 4: 118,726,961 M238T probably benign Het
Olfr564 G A 7: 102,804,285 R269Q not run Het
Ranbp2 G A 10: 58,447,022 V15M probably damaging Het
Rbp3 G T 14: 33,956,464 A790S probably benign Het
Rfx6 T A 10: 51,678,026 S73T probably benign Het
Sec14l3 T A 11: 4,067,972 M84K probably benign Het
Sec23b T A 2: 144,559,396 V59E possibly damaging Het
Slc2a1 T C 4: 119,135,928 V425A possibly damaging Het
Stab2 A T 10: 86,996,894 V89D probably benign Het
Stra8 A G 6: 34,930,964 D117G probably benign Het
Syt17 A T 7: 118,409,971 I338N possibly damaging Het
Tas2r136 T A 6: 132,777,870 Y98F probably benign Het
Tsks C A 7: 44,953,744 probably null Het
Wdr62 A G 7: 30,265,242 V359A possibly damaging Het
Xrcc6 T C 15: 82,016,477 probably null Het
Other mutations in Ptx4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03027:Ptx4 APN 17 25125048 missense possibly damaging 0.81
IGL03373:Ptx4 APN 17 25120899 missense probably benign 0.02
IGL03394:Ptx4 APN 17 25124675 missense probably damaging 1.00
R0559:Ptx4 UTSW 17 25123108 nonsense probably null
R3765:Ptx4 UTSW 17 25122868 missense probably benign 0.02
R4629:Ptx4 UTSW 17 25122763 missense probably damaging 1.00
R4677:Ptx4 UTSW 17 25123126 missense probably benign 0.05
R4938:Ptx4 UTSW 17 25123165 nonsense probably null
R5170:Ptx4 UTSW 17 25123178 missense probably benign 0.01
R5517:Ptx4 UTSW 17 25124786 missense possibly damaging 0.58
R6614:Ptx4 UTSW 17 25122702 missense possibly damaging 0.70
R6993:Ptx4 UTSW 17 25124924 missense possibly damaging 0.70
R7070:Ptx4 UTSW 17 25122997 missense probably benign 0.04
R7230:Ptx4 UTSW 17 25123103 missense possibly damaging 0.95
R7501:Ptx4 UTSW 17 25125192 missense possibly damaging 0.95
R8069:Ptx4 UTSW 17 25122779 missense probably damaging 1.00
R8244:Ptx4 UTSW 17 25122865 missense possibly damaging 0.87
R8370:Ptx4 UTSW 17 25123340 missense possibly damaging 0.90
R8388:Ptx4 UTSW 17 25120923 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TAGTACTGCATGGCCGAAAC -3'
(R):5'- TTGGTCAGCGTCAGAATAGCG -3'

Sequencing Primer
(F):5'- ATGGCCGAAACTCCCTGGTC -3'
(R):5'- CGTCAGAATAGCGCCTGTTG -3'
Posted On2019-12-20