Incidental Mutation 'R7845:Fads1'
ID606587
Institutional Source Beutler Lab
Gene Symbol Fads1
Ensembl Gene ENSMUSG00000010663
Gene Namefatty acid desaturase 1
SynonymsA930006B21Rik, 0710001O03Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7845 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location10182888-10196870 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 10194041 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 345 (H345Q)
Ref Sequence ENSEMBL: ENSMUSP00000010807 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000010807]
Predicted Effect probably damaging
Transcript: ENSMUST00000010807
AA Change: H345Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000010807
Gene: ENSMUSG00000010663
AA Change: H345Q

DomainStartEndE-ValueType
Cyt-b5 22 97 1.32e-19 SMART
transmembrane domain 134 156 N/A INTRINSIC
Pfam:FA_desaturase 158 421 7.4e-35 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 96% (43/45)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the fatty acid desaturase (FADS) gene family. Desaturase enzymes regulate unsaturation of fatty acids through the introduction of double bonds between defined carbons of the fatty acyl chain. FADS family members are considered fusion products composed of an N-terminal cytochrome b5-like domain and a C-terminal multiple membrane-spanning desaturase portion, both of which are characterized by conserved histidine motifs. This gene is clustered with family members FADS1 and FADS2 at 11q12-q13.1; this cluster is thought to have arisen evolutionarily from gene duplication based on its similar exon/intron organization. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit arachidonic acid deficiency with premature lethality and altered prostaglandin levels. Heterozygous mice exhibit an intermediate phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921509C19Rik T C 2: 151,472,309 H483R probably damaging Het
A430078G23Rik T C 8: 3,386,959 Y250H probably damaging Het
Acot2 G T 12: 83,992,988 G424* probably null Het
Adat2 G T 10: 13,552,997 probably benign Het
Bcl2l2 A G 14: 54,884,851 Y157C unknown Het
Bglap2 T A 3: 88,378,694 probably benign Het
Ccdc14 T C 16: 34,715,364 L495P probably damaging Het
Cobl T C 11: 12,365,139 D275G probably benign Het
Cpne2 A G 8: 94,551,204 N72S probably benign Het
D7Ertd443e A G 7: 134,270,248 F628S probably damaging Het
Dars2 A T 1: 161,041,748 S644T probably benign Het
Depdc5 A G 5: 32,903,915 probably null Het
Dip2c A G 13: 9,609,044 S860G probably damaging Het
Dnajc21 T G 15: 10,447,141 H507P probably damaging Het
Eif2ak2 G T 17: 78,863,898 Q359K probably damaging Het
Epha8 T C 4: 136,936,401 E448G probably benign Het
Exoc3l G C 8: 105,290,150 S677R probably damaging Het
Fam118a T A 15: 85,045,851 D93E possibly damaging Het
Fam135a T C 1: 24,029,657 I710M probably benign Het
Fbxw14 T A 9: 109,287,603 I13F probably damaging Het
Gemin6 A G 17: 80,225,661 S8G probably benign Het
Ints2 A T 11: 86,238,263 M498K possibly damaging Het
Man2a2 G C 7: 80,368,865 A82G probably benign Het
Mast1 C A 8: 84,925,325 E343* probably null Het
Micu1 T C 10: 59,839,785 probably null Het
Mis18bp1 A G 12: 65,149,328 I554T probably benign Het
Mrps28 T A 3: 8,923,715 N28Y possibly damaging Het
Mtpap T A 18: 4,387,134 S395T possibly damaging Het
Muc16 A T 9: 18,640,773 H4741Q probably benign Het
Ogfr GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG 2: 180,595,266 probably benign Het
Olfr1294 C A 2: 111,538,167 G41* probably null Het
Olfr1340 T C 4: 118,726,961 M238T probably benign Het
Olfr564 G A 7: 102,804,285 R269Q not run Het
Ptx4 T C 17: 25,124,954 Y393H possibly damaging Het
Ranbp2 G A 10: 58,447,022 V15M probably damaging Het
Rbp3 G T 14: 33,956,464 A790S probably benign Het
Rfx6 T A 10: 51,678,026 S73T probably benign Het
Sec14l3 T A 11: 4,067,972 M84K probably benign Het
Sec23b T A 2: 144,559,396 V59E possibly damaging Het
Slc2a1 T C 4: 119,135,928 V425A possibly damaging Het
Stab2 A T 10: 86,996,894 V89D probably benign Het
Stra8 A G 6: 34,930,964 D117G probably benign Het
Syt17 A T 7: 118,409,971 I338N possibly damaging Het
Tas2r136 T A 6: 132,777,870 Y98F probably benign Het
Tsks C A 7: 44,953,744 probably null Het
Wdr62 A G 7: 30,265,242 V359A possibly damaging Het
Xrcc6 T C 15: 82,016,477 probably null Het
Other mutations in Fads1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01512:Fads1 APN 19 10183142 missense probably benign 0.02
IGL01536:Fads1 APN 19 10194030 missense probably benign 0.36
IGL02642:Fads1 APN 19 10186421 missense probably damaging 1.00
teewinot UTSW 19 10185727 nonsense probably null
R0023:Fads1 UTSW 19 10186897 splice site probably benign
R0023:Fads1 UTSW 19 10186897 splice site probably benign
R0367:Fads1 UTSW 19 10183065 missense probably benign 0.12
R0464:Fads1 UTSW 19 10183065 missense probably benign 0.12
R0465:Fads1 UTSW 19 10183065 missense probably benign 0.12
R0534:Fads1 UTSW 19 10183065 missense probably benign 0.12
R0848:Fads1 UTSW 19 10183065 missense probably benign 0.12
R1456:Fads1 UTSW 19 10185752 missense probably benign 0.06
R1697:Fads1 UTSW 19 10194100 splice site probably benign
R5576:Fads1 UTSW 19 10185874 missense probably benign 0.00
R5640:Fads1 UTSW 19 10186403 missense probably damaging 1.00
R6243:Fads1 UTSW 19 10185727 nonsense probably null
R6379:Fads1 UTSW 19 10183187 missense probably damaging 1.00
R7593:Fads1 UTSW 19 10184997 missense probably damaging 1.00
Z1176:Fads1 UTSW 19 10193704 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTACAGGTGACAGATGGGTC -3'
(R):5'- TCTCCATGTCAGAGTGCTGG -3'

Sequencing Primer
(F):5'- CAGATGGGTCTGCGGGC -3'
(R):5'- TCAGAGTGCTGGGTCTTCC -3'
Posted On2019-12-20