Incidental Mutation 'R7846:Kdm5b'
ID606589
Institutional Source Beutler Lab
Gene Symbol Kdm5b
Ensembl Gene ENSMUSG00000042207
Gene Namelysine (K)-specific demethylase 5B
SynonymsJarid1b, Plu1, Rb-Bp2, 2210016I17Rik, 2010009J12Rik, PLU-1, D1Ertd202e
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.266) question?
Stock #R7846 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location134560171-134635285 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 134617840 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 913 (R913H)
Ref Sequence ENSEMBL: ENSMUSP00000038138 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047714] [ENSMUST00000112198]
Predicted Effect probably damaging
Transcript: ENSMUST00000047714
AA Change: R913H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000038138
Gene: ENSMUSG00000042207
AA Change: R913H

DomainStartEndE-ValueType
low complexity region 7 30 N/A INTRINSIC
JmjN 31 72 2.87e-20 SMART
ARID 94 183 7.39e-32 SMART
BRIGHT 98 188 1.51e-35 SMART
low complexity region 228 239 N/A INTRINSIC
PHD 311 357 6.15e-14 SMART
JmjC 453 619 2.33e-67 SMART
Pfam:zf-C5HC2 692 744 2.2e-17 PFAM
Pfam:PLU-1 757 1088 5.6e-92 PFAM
low complexity region 1097 1109 N/A INTRINSIC
PHD 1178 1222 6.2e-10 SMART
low complexity region 1225 1236 N/A INTRINSIC
low complexity region 1406 1417 N/A INTRINSIC
low complexity region 1470 1484 N/A INTRINSIC
PHD 1486 1536 1.18e-6 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000112198
AA Change: R913H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000107817
Gene: ENSMUSG00000042207
AA Change: R913H

DomainStartEndE-ValueType
low complexity region 7 30 N/A INTRINSIC
JmjN 31 72 2.87e-20 SMART
ARID 94 183 7.39e-32 SMART
BRIGHT 98 188 1.51e-35 SMART
low complexity region 228 239 N/A INTRINSIC
PHD 311 357 6.15e-14 SMART
JmjC 453 619 2.33e-67 SMART
Pfam:zf-C5HC2 692 745 6.7e-21 PFAM
Pfam:PLU-1 756 1088 6e-94 PFAM
low complexity region 1097 1109 N/A INTRINSIC
PHD 1178 1222 6.2e-10 SMART
low complexity region 1225 1236 N/A INTRINSIC
low complexity region 1406 1417 N/A INTRINSIC
low complexity region 1470 1484 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a lysine-specific histone demethylase that belongs to the jumonji/ARID domain-containing family of histone demethylases. The encoded protein is capable of demethylating tri-, di- and monomethylated lysine 4 of histone H3. This protein plays a role in the transcriptional repression or certain tumor suppressor genes and is upregulated in certain cancer cells. This protein may also play a role in genome stability and DNA repair. Homozygous mutant mice display decreased body weight, decreased female fertility, lower uterine weight, and a delay in mammary development. Knockout of this gene has also been associated with embryonic lethality. [provided by RefSeq, Dec 2016]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit decreased body weight, background-sensitive premature mortality, decreased female fertility, delayed mammary gland development, decreased serum estradiol levels, and reduced mammary epithelial cell proliferation in early puberty. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abraxas1 A G 5: 100,806,832 V247A probably damaging Het
Acot13 G T 13: 24,818,150 T103K probably damaging Het
Acsl6 A T 11: 54,361,075 I683F probably damaging Het
Acss2 A T 2: 155,561,033 H577L probably damaging Het
Ahctf1 A T 1: 179,787,073 V382D probably damaging Het
Aldob T C 4: 49,538,858 H220R probably damaging Het
Ankrd1 C T 19: 36,116,818 V169M probably damaging Het
Atp5a1 G A 18: 77,781,315 R413H possibly damaging Het
Ccdc129 A G 6: 55,978,335 Q976R possibly damaging Het
Cep76 A G 18: 67,629,905 F283L probably damaging Het
Chrna5 A T 9: 55,005,107 D397V probably benign Het
Coro7 T C 16: 4,670,536 D90G probably damaging Het
Csnk1g3 A G 18: 53,948,105 N383D probably benign Het
Cwf19l2 C A 9: 3,477,889 Q865K probably damaging Het
Cyth2 C A 7: 45,810,954 W149C probably damaging Het
D3Ertd254e C A 3: 36,165,589 T587N probably benign Het
Dgkh C A 14: 78,618,586 R349L probably damaging Het
Dnajc1 G T 2: 18,219,893 T383N possibly damaging Het
Extl3 A T 14: 65,075,732 M667K probably damaging Het
Fam149a G T 8: 45,358,641 A75E Het
Fgd4 T G 16: 16,422,726 Q713P probably damaging Het
Frat2 T A 19: 41,847,776 I46F probably damaging Het
Gm11639 T A 11: 104,714,745 probably null Het
Gm13023 A T 4: 143,793,993 D269V probably benign Het
Gzmc A G 14: 56,231,560 V234A probably damaging Het
H2-Q4 A G 17: 35,380,158 N135D probably damaging Het
Ighv1-85 A T 12: 116,000,317 V21D possibly damaging Het
Kcna6 A T 6: 126,739,020 V302E probably damaging Het
Kdm3b G T 18: 34,809,240 V795L possibly damaging Het
Lpp T A 16: 24,608,126 M1K probably null Het
Med12l T C 3: 59,264,934 S1704P probably damaging Het
Mfsd10 G T 5: 34,636,112 S95* probably null Het
Napepld C T 5: 21,675,723 E225K probably benign Het
Ndfip2 T C 14: 105,298,014 F245L probably damaging Het
Oaf G A 9: 43,222,780 R215C probably damaging Het
Olfr370 A G 8: 83,541,897 H251R probably damaging Het
Olfr478 A G 7: 108,031,992 I117T probably benign Het
Olfr53 C T 7: 140,652,461 H161Y probably damaging Het
Olfr625-ps1 A G 7: 103,683,200 I161V probably benign Het
Olfr640 A G 7: 104,021,529 I263T possibly damaging Het
Olfr911-ps1 A G 9: 38,524,379 T216A probably benign Het
Pcdhgb2 A T 18: 37,692,220 I755F possibly damaging Het
Pde4dip A G 3: 97,715,174 L1573P probably damaging Het
Peg3 A T 7: 6,710,651 V524E probably damaging Het
Phc1 G T 6: 122,333,370 T126N probably damaging Het
Phf1 C A 17: 26,935,317 Y169* probably null Het
Prl3a1 G A 13: 27,272,459 E99K probably damaging Het
Prss57 G A 10: 79,787,379 A78V probably damaging Het
Ptprb A T 10: 116,283,548 T196S probably benign Het
Rgsl1 A T 1: 153,826,037 C224S possibly damaging Het
Rtn4 T C 11: 29,693,274 V29A unknown Het
Selplg G A 5: 113,819,420 T275M probably damaging Het
Skint11 C T 4: 114,244,879 T363I possibly damaging Het
Slc22a29 T A 19: 8,193,487 I289F probably benign Het
Slc26a2 A G 18: 61,198,704 S552P probably benign Het
Sptb T A 12: 76,608,526 K1480* probably null Het
Sptbn1 C A 11: 30,142,153 M537I probably damaging Het
Sqor A T 2: 122,785,088 H43L probably benign Het
Srcin1 C A 11: 97,526,100 E913* probably null Het
Srgap1 A G 10: 121,785,492 L1032P probably damaging Het
Stc2 T C 11: 31,365,413 K142R probably benign Het
Stox1 A C 10: 62,659,526 N989K probably damaging Het
Tert T A 13: 73,628,195 L355H probably damaging Het
Tfb2m A G 1: 179,531,361 F319S probably damaging Het
Trps1 A G 15: 50,831,877 F341L probably damaging Het
Ttk T C 9: 83,843,679 V218A probably benign Het
Vmn1r159 A G 7: 22,843,271 I112T probably benign Het
Vps8 C A 16: 21,532,320 Q916K probably benign Het
Wdr12 A T 1: 60,082,066 D364E probably damaging Het
Ylpm1 A G 12: 85,057,268 E2019G probably damaging Het
Zfp507 A G 7: 35,794,538 L360P probably damaging Het
Other mutations in Kdm5b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00230:Kdm5b APN 1 134620955 missense probably damaging 1.00
IGL01458:Kdm5b APN 1 134621986 missense possibly damaging 0.53
IGL01567:Kdm5b APN 1 134602540 missense probably damaging 1.00
IGL01625:Kdm5b APN 1 134617968 missense possibly damaging 0.74
IGL01970:Kdm5b APN 1 134600727 missense probably damaging 1.00
IGL02183:Kdm5b APN 1 134624931 missense probably benign 0.09
IGL02592:Kdm5b APN 1 134624853 missense probably damaging 0.99
IGL02695:Kdm5b APN 1 134604485 missense possibly damaging 0.94
IGL02697:Kdm5b APN 1 134588773 splice site probably benign
IGL03036:Kdm5b APN 1 134608937 missense probably damaging 1.00
IGL03056:Kdm5b APN 1 134587979 missense probably damaging 0.99
IGL03206:Kdm5b APN 1 134627317 missense probably benign
IGL03342:Kdm5b APN 1 134602576 missense probably benign 0.00
IGL03388:Kdm5b APN 1 134627322 missense probably benign
amaryllis UTSW 1 134609061 critical splice donor site probably null
PIT4486001:Kdm5b UTSW 1 134628685 missense probably damaging 1.00
R0233:Kdm5b UTSW 1 134604634 splice site probably benign
R0334:Kdm5b UTSW 1 134604522 missense probably damaging 0.99
R0504:Kdm5b UTSW 1 134621023 critical splice donor site probably null
R0505:Kdm5b UTSW 1 134602571 missense probably damaging 0.96
R0521:Kdm5b UTSW 1 134618033 missense possibly damaging 0.65
R1004:Kdm5b UTSW 1 134588904 missense possibly damaging 0.71
R1087:Kdm5b UTSW 1 134600637 missense probably damaging 1.00
R1126:Kdm5b UTSW 1 134613991 missense possibly damaging 0.90
R1221:Kdm5b UTSW 1 134599091 missense probably damaging 0.98
R1230:Kdm5b UTSW 1 134613254 missense probably damaging 1.00
R1345:Kdm5b UTSW 1 134630550 missense possibly damaging 0.94
R1482:Kdm5b UTSW 1 134624897 missense probably damaging 1.00
R1582:Kdm5b UTSW 1 134624853 missense probably damaging 0.99
R1653:Kdm5b UTSW 1 134602481 missense probably damaging 1.00
R1693:Kdm5b UTSW 1 134597576 splice site probably benign
R1721:Kdm5b UTSW 1 134613181 splice site probably benign
R1741:Kdm5b UTSW 1 134618017 missense possibly damaging 0.82
R1762:Kdm5b UTSW 1 134604467 nonsense probably null
R1820:Kdm5b UTSW 1 134597670 missense possibly damaging 0.87
R1872:Kdm5b UTSW 1 134624994 missense probably damaging 1.00
R1966:Kdm5b UTSW 1 134613873 splice site probably null
R2056:Kdm5b UTSW 1 134613214 missense probably benign 0.05
R2059:Kdm5b UTSW 1 134613214 missense probably benign 0.05
R2405:Kdm5b UTSW 1 134609016 missense probably damaging 0.97
R3417:Kdm5b UTSW 1 134587977 missense probably damaging 1.00
R3771:Kdm5b UTSW 1 134613345 missense probably damaging 1.00
R3783:Kdm5b UTSW 1 134630542 missense probably benign
R3803:Kdm5b UTSW 1 134615941 missense probably benign 0.07
R3980:Kdm5b UTSW 1 134619670 missense probably benign 0.11
R3983:Kdm5b UTSW 1 134631304 missense possibly damaging 0.91
R4013:Kdm5b UTSW 1 134627329 missense possibly damaging 0.86
R4162:Kdm5b UTSW 1 134625161 missense probably benign 0.01
R4701:Kdm5b UTSW 1 134606012 intron probably benign
R4791:Kdm5b UTSW 1 134630800 missense possibly damaging 0.82
R4836:Kdm5b UTSW 1 134593315 splice site probably null
R4924:Kdm5b UTSW 1 134631351 missense probably benign 0.00
R5135:Kdm5b UTSW 1 134588746 intron probably benign
R5248:Kdm5b UTSW 1 134620997 missense probably benign 0.11
R5290:Kdm5b UTSW 1 134622099 splice site probably null
R5358:Kdm5b UTSW 1 134607694 nonsense probably null
R5388:Kdm5b UTSW 1 134608897 nonsense probably null
R5396:Kdm5b UTSW 1 134622098 splice site probably null
R5397:Kdm5b UTSW 1 134622098 splice site probably null
R5398:Kdm5b UTSW 1 134622098 splice site probably null
R5399:Kdm5b UTSW 1 134622098 splice site probably null
R5529:Kdm5b UTSW 1 134588003 missense probably damaging 1.00
R5540:Kdm5b UTSW 1 134631241 missense probably damaging 0.98
R5661:Kdm5b UTSW 1 134599073 missense probably benign 0.01
R5663:Kdm5b UTSW 1 134630635 missense probably benign
R5822:Kdm5b UTSW 1 134588773 splice site probably benign
R6226:Kdm5b UTSW 1 134608878 missense probably damaging 0.99
R6368:Kdm5b UTSW 1 134599207 missense probably damaging 1.00
R6681:Kdm5b UTSW 1 134613269 missense possibly damaging 0.90
R6715:Kdm5b UTSW 1 134609061 critical splice donor site probably null
R7132:Kdm5b UTSW 1 134599106 missense probably damaging 1.00
R7202:Kdm5b UTSW 1 134624759 missense probably benign
R7258:Kdm5b UTSW 1 134621021 missense probably damaging 1.00
R7335:Kdm5b UTSW 1 134560439 missense probably damaging 1.00
R7420:Kdm5b UTSW 1 134604497 missense probably benign 0.14
R7426:Kdm5b UTSW 1 134595833 missense probably benign 0.02
R7452:Kdm5b UTSW 1 134624948 missense probably damaging 1.00
R7595:Kdm5b UTSW 1 134608966 missense probably benign 0.00
R7612:Kdm5b UTSW 1 134624918 nonsense probably null
R7704:Kdm5b UTSW 1 134587931 missense probably damaging 1.00
R8115:Kdm5b UTSW 1 134619673 missense possibly damaging 0.83
R8146:Kdm5b UTSW 1 134625126 missense probably benign 0.05
R8160:Kdm5b UTSW 1 134613919 missense probably damaging 1.00
X0063:Kdm5b UTSW 1 134588876 missense probably benign 0.07
Z1176:Kdm5b UTSW 1 134625035 missense probably damaging 1.00
Z1177:Kdm5b UTSW 1 134595798 frame shift probably null
Predicted Primers PCR Primer
(F):5'- GGCTCTCAGGTGTCATTTACG -3'
(R):5'- TTCTGACACTGTTAGCAGCTCC -3'

Sequencing Primer
(F):5'- TGGGATTAAAGTTGCCCACC -3'
(R):5'- CTGCAGGCGGGCCATAG -3'
Posted On2019-12-20