Incidental Mutation 'R7846:Napepld'
ID606602
Institutional Source Beutler Lab
Gene Symbol Napepld
Ensembl Gene ENSMUSG00000044968
Gene NameN-acyl phosphatidylethanolamine phospholipase D
SynonymsNAPE-PLD
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7846 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location21662901-21701396 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 21675723 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Lysine at position 225 (E225K)
Ref Sequence ENSEMBL: ENSMUSP00000054458 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060899] [ENSMUST00000115217]
Predicted Effect probably benign
Transcript: ENSMUST00000060899
AA Change: E225K

PolyPhen 2 Score 0.129 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000054458
Gene: ENSMUSG00000044968
AA Change: E225K

DomainStartEndE-ValueType
low complexity region 25 45 N/A INTRINSIC
Pfam:Lactamase_B_3 126 343 1.5e-14 PFAM
Pfam:Lactamase_B_2 142 344 2.7e-42 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115217
AA Change: E225K

PolyPhen 2 Score 0.129 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000110872
Gene: ENSMUSG00000044968
AA Change: E225K

DomainStartEndE-ValueType
low complexity region 25 45 N/A INTRINSIC
Pfam:Lactamase_B_3 126 343 1.3e-13 PFAM
Pfam:Lactamase_B_2 142 344 1.4e-39 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] NAPEPLD is a phospholipase D type enzyme that catalyzes the release of N-acylethanolamine (NAE) from N-acyl-phosphatidylethanolamine (NAPE) in the second step of the biosynthesis of N-acylethanolamine (Okamoto et al., 2004 [PubMed 14634025]).[supplied by OMIM, Oct 2008]
PHENOTYPE: Mice homozygous for a null mutation are viable and healthy, but have abnormal brain levels of N-acyl ethanolamines and N-acyl phosphatidylethanolamines. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abraxas1 A G 5: 100,806,832 V247A probably damaging Het
Acot13 G T 13: 24,818,150 T103K probably damaging Het
Acsl6 A T 11: 54,361,075 I683F probably damaging Het
Acss2 A T 2: 155,561,033 H577L probably damaging Het
Ahctf1 A T 1: 179,787,073 V382D probably damaging Het
Aldob T C 4: 49,538,858 H220R probably damaging Het
Ankrd1 C T 19: 36,116,818 V169M probably damaging Het
Atp5a1 G A 18: 77,781,315 R413H possibly damaging Het
Ccdc129 A G 6: 55,978,335 Q976R possibly damaging Het
Cep76 A G 18: 67,629,905 F283L probably damaging Het
Chrna5 A T 9: 55,005,107 D397V probably benign Het
Coro7 T C 16: 4,670,536 D90G probably damaging Het
Csnk1g3 A G 18: 53,948,105 N383D probably benign Het
Cwf19l2 C A 9: 3,477,889 Q865K probably damaging Het
Cyth2 C A 7: 45,810,954 W149C probably damaging Het
D3Ertd254e C A 3: 36,165,589 T587N probably benign Het
Dgkh C A 14: 78,618,586 R349L probably damaging Het
Dnajc1 G T 2: 18,219,893 T383N possibly damaging Het
Extl3 A T 14: 65,075,732 M667K probably damaging Het
Fam149a G T 8: 45,358,641 A75E Het
Fgd4 T G 16: 16,422,726 Q713P probably damaging Het
Frat2 T A 19: 41,847,776 I46F probably damaging Het
Gm11639 T A 11: 104,714,745 probably null Het
Gm13023 A T 4: 143,793,993 D269V probably benign Het
Gzmc A G 14: 56,231,560 V234A probably damaging Het
H2-Q4 A G 17: 35,380,158 N135D probably damaging Het
Ighv1-85 A T 12: 116,000,317 V21D possibly damaging Het
Kcna6 A T 6: 126,739,020 V302E probably damaging Het
Kdm3b G T 18: 34,809,240 V795L possibly damaging Het
Kdm5b G A 1: 134,617,840 R913H probably damaging Het
Lpp T A 16: 24,608,126 M1K probably null Het
Med12l T C 3: 59,264,934 S1704P probably damaging Het
Mfsd10 G T 5: 34,636,112 S95* probably null Het
Ndfip2 T C 14: 105,298,014 F245L probably damaging Het
Oaf G A 9: 43,222,780 R215C probably damaging Het
Olfr370 A G 8: 83,541,897 H251R probably damaging Het
Olfr478 A G 7: 108,031,992 I117T probably benign Het
Olfr53 C T 7: 140,652,461 H161Y probably damaging Het
Olfr625-ps1 A G 7: 103,683,200 I161V probably benign Het
Olfr640 A G 7: 104,021,529 I263T possibly damaging Het
Olfr911-ps1 A G 9: 38,524,379 T216A probably benign Het
Pcdhgb2 A T 18: 37,692,220 I755F possibly damaging Het
Pde4dip A G 3: 97,715,174 L1573P probably damaging Het
Peg3 A T 7: 6,710,651 V524E probably damaging Het
Phc1 G T 6: 122,333,370 T126N probably damaging Het
Phf1 C A 17: 26,935,317 Y169* probably null Het
Prl3a1 G A 13: 27,272,459 E99K probably damaging Het
Prss57 G A 10: 79,787,379 A78V probably damaging Het
Ptprb A T 10: 116,283,548 T196S probably benign Het
Rgsl1 A T 1: 153,826,037 C224S possibly damaging Het
Rtn4 T C 11: 29,693,274 V29A unknown Het
Selplg G A 5: 113,819,420 T275M probably damaging Het
Skint11 C T 4: 114,244,879 T363I possibly damaging Het
Slc22a29 T A 19: 8,193,487 I289F probably benign Het
Slc26a2 A G 18: 61,198,704 S552P probably benign Het
Sptb T A 12: 76,608,526 K1480* probably null Het
Sptbn1 C A 11: 30,142,153 M537I probably damaging Het
Sqor A T 2: 122,785,088 H43L probably benign Het
Srcin1 C A 11: 97,526,100 E913* probably null Het
Srgap1 A G 10: 121,785,492 L1032P probably damaging Het
Stc2 T C 11: 31,365,413 K142R probably benign Het
Stox1 A C 10: 62,659,526 N989K probably damaging Het
Tert T A 13: 73,628,195 L355H probably damaging Het
Tfb2m A G 1: 179,531,361 F319S probably damaging Het
Trps1 A G 15: 50,831,877 F341L probably damaging Het
Ttk T C 9: 83,843,679 V218A probably benign Het
Vmn1r159 A G 7: 22,843,271 I112T probably benign Het
Vps8 C A 16: 21,532,320 Q916K probably benign Het
Wdr12 A T 1: 60,082,066 D364E probably damaging Het
Ylpm1 A G 12: 85,057,268 E2019G probably damaging Het
Zfp507 A G 7: 35,794,538 L360P probably damaging Het
Other mutations in Napepld
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00848:Napepld APN 5 21683193 missense probably benign 0.11
IGL01659:Napepld APN 5 21675716 missense probably damaging 0.99
IGL01726:Napepld APN 5 21675659 missense possibly damaging 0.93
IGL02083:Napepld APN 5 21676067 missense probably damaging 1.00
IGL02425:Napepld APN 5 21683442 missense probably benign 0.19
R1763:Napepld UTSW 5 21683410 missense probably benign 0.00
R1903:Napepld UTSW 5 21665272 missense probably damaging 0.97
R2166:Napepld UTSW 5 21683232 missense possibly damaging 0.48
R3861:Napepld UTSW 5 21683289 missense probably benign 0.32
R4899:Napepld UTSW 5 21683440 missense probably benign 0.00
R5629:Napepld UTSW 5 21675903 missense probably benign 0.01
R5794:Napepld UTSW 5 21683431 missense possibly damaging 0.93
R6273:Napepld UTSW 5 21665322 missense probably benign 0.01
R7619:Napepld UTSW 5 21675848 missense probably damaging 1.00
R7810:Napepld UTSW 5 21683265 missense possibly damaging 0.86
R7852:Napepld UTSW 5 21683173 missense probably benign 0.00
R8050:Napepld UTSW 5 21665321 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGAAGAATCGACTCCAAGGC -3'
(R):5'- ACGAGCTCATCTTCCTCACG -3'

Sequencing Primer
(F):5'- TCGACTCCAAGGCCCTAG -3'
(R):5'- TCGCAGTACATGGGTCCGAAG -3'
Posted On2019-12-20