Incidental Mutation 'R7846:Prss57'
ID606625
Institutional Source Beutler Lab
Gene Symbol Prss57
Ensembl Gene ENSMUSG00000020323
Gene Nameprotease, serine 57
Synonyms2900092M14Rik, Prssl1, GLGL782, UNQ782
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.057) question?
Stock #R7846 (G1)
Quality Score225.009
Status Not validated
Chromosome10
Chromosomal Location79781474-79790961 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 79787379 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 78 (A78V)
Ref Sequence ENSEMBL: ENSMUSP00000020573 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020573] [ENSMUST00000020575] [ENSMUST00000169684]
Predicted Effect probably damaging
Transcript: ENSMUST00000020573
AA Change: A78V

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000020573
Gene: ENSMUSG00000020323
AA Change: A78V

DomainStartEndE-ValueType
signal peptide 1 37 N/A INTRINSIC
Tryp_SPc 39 264 1.53e-70 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000020575
SMART Domains Protein: ENSMUSP00000020575
Gene: ENSMUSG00000020325

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
FOLN 96 118 4.13e-6 SMART
KAZAL 116 165 1.69e-11 SMART
FOLN 168 191 1.09e-5 SMART
KAZAL 197 241 1.02e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000167987
SMART Domains Protein: ENSMUSP00000130448
Gene: ENSMUSG00000020323

DomainStartEndE-ValueType
Pfam:Trypsin 1 75 1.4e-10 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000169684
AA Change: A78V

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000132215
Gene: ENSMUSG00000020323
AA Change: A78V

DomainStartEndE-ValueType
signal peptide 1 37 N/A INTRINSIC
Tryp_SPc 39 264 1.53e-70 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000171681
SMART Domains Protein: ENSMUSP00000131642
Gene: ENSMUSG00000020323

DomainStartEndE-ValueType
Tryp_SPc 1 87 3.16e-1 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an arginine-specific serine protease and member of the peptidase S1 family of proteins. The encoded protein may undergo proteolytic activation before storage in azurophil granules, in neutrophil cells of the immune system. Following neutrophil activation, the protease is released into the pericellular environment, where it may play a role in defense against microbial pathogens. [provided by RefSeq, Jul 2016]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abraxas1 A G 5: 100,806,832 V247A probably damaging Het
Acot13 G T 13: 24,818,150 T103K probably damaging Het
Acsl6 A T 11: 54,361,075 I683F probably damaging Het
Acss2 A T 2: 155,561,033 H577L probably damaging Het
Ahctf1 A T 1: 179,787,073 V382D probably damaging Het
Aldob T C 4: 49,538,858 H220R probably damaging Het
Ankrd1 C T 19: 36,116,818 V169M probably damaging Het
Atp5a1 G A 18: 77,781,315 R413H possibly damaging Het
Ccdc129 A G 6: 55,978,335 Q976R possibly damaging Het
Cep76 A G 18: 67,629,905 F283L probably damaging Het
Chrna5 A T 9: 55,005,107 D397V probably benign Het
Coro7 T C 16: 4,670,536 D90G probably damaging Het
Csnk1g3 A G 18: 53,948,105 N383D probably benign Het
Cwf19l2 C A 9: 3,477,889 Q865K probably damaging Het
Cyth2 C A 7: 45,810,954 W149C probably damaging Het
D3Ertd254e C A 3: 36,165,589 T587N probably benign Het
Dgkh C A 14: 78,618,586 R349L probably damaging Het
Dnajc1 G T 2: 18,219,893 T383N possibly damaging Het
Extl3 A T 14: 65,075,732 M667K probably damaging Het
Fam149a G T 8: 45,358,641 A75E Het
Fgd4 T G 16: 16,422,726 Q713P probably damaging Het
Frat2 T A 19: 41,847,776 I46F probably damaging Het
Gm11639 T A 11: 104,714,745 probably null Het
Gm13023 A T 4: 143,793,993 D269V probably benign Het
Gzmc A G 14: 56,231,560 V234A probably damaging Het
H2-Q4 A G 17: 35,380,158 N135D probably damaging Het
Ighv1-85 A T 12: 116,000,317 V21D possibly damaging Het
Kcna6 A T 6: 126,739,020 V302E probably damaging Het
Kdm3b G T 18: 34,809,240 V795L possibly damaging Het
Kdm5b G A 1: 134,617,840 R913H probably damaging Het
Lpp T A 16: 24,608,126 M1K probably null Het
Med12l T C 3: 59,264,934 S1704P probably damaging Het
Mfsd10 G T 5: 34,636,112 S95* probably null Het
Napepld C T 5: 21,675,723 E225K probably benign Het
Ndfip2 T C 14: 105,298,014 F245L probably damaging Het
Oaf G A 9: 43,222,780 R215C probably damaging Het
Olfr370 A G 8: 83,541,897 H251R probably damaging Het
Olfr478 A G 7: 108,031,992 I117T probably benign Het
Olfr53 C T 7: 140,652,461 H161Y probably damaging Het
Olfr625-ps1 A G 7: 103,683,200 I161V probably benign Het
Olfr640 A G 7: 104,021,529 I263T possibly damaging Het
Olfr911-ps1 A G 9: 38,524,379 T216A probably benign Het
Pcdhgb2 A T 18: 37,692,220 I755F possibly damaging Het
Pde4dip A G 3: 97,715,174 L1573P probably damaging Het
Peg3 A T 7: 6,710,651 V524E probably damaging Het
Phc1 G T 6: 122,333,370 T126N probably damaging Het
Phf1 C A 17: 26,935,317 Y169* probably null Het
Prl3a1 G A 13: 27,272,459 E99K probably damaging Het
Ptprb A T 10: 116,283,548 T196S probably benign Het
Rgsl1 A T 1: 153,826,037 C224S possibly damaging Het
Rtn4 T C 11: 29,693,274 V29A unknown Het
Selplg G A 5: 113,819,420 T275M probably damaging Het
Skint11 C T 4: 114,244,879 T363I possibly damaging Het
Slc22a29 T A 19: 8,193,487 I289F probably benign Het
Slc26a2 A G 18: 61,198,704 S552P probably benign Het
Sptb T A 12: 76,608,526 K1480* probably null Het
Sptbn1 C A 11: 30,142,153 M537I probably damaging Het
Sqor A T 2: 122,785,088 H43L probably benign Het
Srcin1 C A 11: 97,526,100 E913* probably null Het
Srgap1 A G 10: 121,785,492 L1032P probably damaging Het
Stc2 T C 11: 31,365,413 K142R probably benign Het
Stox1 A C 10: 62,659,526 N989K probably damaging Het
Tert T A 13: 73,628,195 L355H probably damaging Het
Tfb2m A G 1: 179,531,361 F319S probably damaging Het
Trps1 A G 15: 50,831,877 F341L probably damaging Het
Ttk T C 9: 83,843,679 V218A probably benign Het
Vmn1r159 A G 7: 22,843,271 I112T probably benign Het
Vps8 C A 16: 21,532,320 Q916K probably benign Het
Wdr12 A T 1: 60,082,066 D364E probably damaging Het
Ylpm1 A G 12: 85,057,268 E2019G probably damaging Het
Zfp507 A G 7: 35,794,538 L360P probably damaging Het
Other mutations in Prss57
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01548:Prss57 APN 10 79785747 unclassified probably benign
IGL02675:Prss57 APN 10 79787475 missense probably benign 0.02
R0882:Prss57 UTSW 10 79785865 missense probably damaging 1.00
R1777:Prss57 UTSW 10 79787385 missense possibly damaging 0.91
R2257:Prss57 UTSW 10 79787370 missense probably damaging 1.00
R5055:Prss57 UTSW 10 79784344 critical splice donor site probably null
R7567:Prss57 UTSW 10 79787400 missense probably benign 0.02
R7929:Prss57 UTSW 10 79787379 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- ATGTGAGTCCAAACAGTAGCAC -3'
(R):5'- CAGGGCTGTGCTCCATTG -3'

Sequencing Primer
(F):5'- ACAGTAGCACATGTCGCTTG -3'
(R):5'- GTGCTCCATTGCCCTTGATTTAC -3'
Posted On2019-12-20