Incidental Mutation 'R7846:Extl3'
ID606641
Institutional Source Beutler Lab
Gene Symbol Extl3
Ensembl Gene ENSMUSG00000021978
Gene Nameexostoses (multiple)-like 3
Synonyms2900009G18Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7846 (G1)
Quality Score225.009
Status Not validated
Chromosome14
Chromosomal Location65052060-65149855 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 65075732 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 667 (M667K)
Ref Sequence ENSEMBL: ENSMUSP00000022550 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022550] [ENSMUST00000225633]
Predicted Effect probably damaging
Transcript: ENSMUST00000022550
AA Change: M667K

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000022550
Gene: ENSMUSG00000021978
AA Change: M667K

DomainStartEndE-ValueType
transmembrane domain 29 51 N/A INTRINSIC
coiled coil region 81 150 N/A INTRINSIC
Pfam:Exostosin 190 500 1.6e-60 PFAM
Pfam:Glyco_transf_64 663 904 1.3e-101 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000225633
AA Change: M667K

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a single-pass membrane protein which functions as a glycosyltransferase. The encoded protein catalyzes the transfer of N-acetylglucosamine to glycosaminoglycan chains. This reaction is important in heparin and heparan sulfate synthesis. Alternative splicing results in the multiple transcript variants. [provided by RefSeq, Nov 2012]
PHENOTYPE: Mice homozygous for a null mutation display embryonic lethality during organogenesis and lack heparan sulfate derived disaccharides. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abraxas1 A G 5: 100,806,832 V247A probably damaging Het
Acot13 G T 13: 24,818,150 T103K probably damaging Het
Acsl6 A T 11: 54,361,075 I683F probably damaging Het
Acss2 A T 2: 155,561,033 H577L probably damaging Het
Ahctf1 A T 1: 179,787,073 V382D probably damaging Het
Aldob T C 4: 49,538,858 H220R probably damaging Het
Ankrd1 C T 19: 36,116,818 V169M probably damaging Het
Atp5a1 G A 18: 77,781,315 R413H possibly damaging Het
Ccdc129 A G 6: 55,978,335 Q976R possibly damaging Het
Cep76 A G 18: 67,629,905 F283L probably damaging Het
Chrna5 A T 9: 55,005,107 D397V probably benign Het
Coro7 T C 16: 4,670,536 D90G probably damaging Het
Csnk1g3 A G 18: 53,948,105 N383D probably benign Het
Cwf19l2 C A 9: 3,477,889 Q865K probably damaging Het
Cyth2 C A 7: 45,810,954 W149C probably damaging Het
D3Ertd254e C A 3: 36,165,589 T587N probably benign Het
Dgkh C A 14: 78,618,586 R349L probably damaging Het
Dnajc1 G T 2: 18,219,893 T383N possibly damaging Het
Fam149a G T 8: 45,358,641 A75E Het
Fgd4 T G 16: 16,422,726 Q713P probably damaging Het
Frat2 T A 19: 41,847,776 I46F probably damaging Het
Gm11639 T A 11: 104,714,745 probably null Het
Gm13023 A T 4: 143,793,993 D269V probably benign Het
Gzmc A G 14: 56,231,560 V234A probably damaging Het
H2-Q4 A G 17: 35,380,158 N135D probably damaging Het
Ighv1-85 A T 12: 116,000,317 V21D possibly damaging Het
Kcna6 A T 6: 126,739,020 V302E probably damaging Het
Kdm3b G T 18: 34,809,240 V795L possibly damaging Het
Kdm5b G A 1: 134,617,840 R913H probably damaging Het
Lpp T A 16: 24,608,126 M1K probably null Het
Med12l T C 3: 59,264,934 S1704P probably damaging Het
Mfsd10 G T 5: 34,636,112 S95* probably null Het
Napepld C T 5: 21,675,723 E225K probably benign Het
Ndfip2 T C 14: 105,298,014 F245L probably damaging Het
Oaf G A 9: 43,222,780 R215C probably damaging Het
Olfr370 A G 8: 83,541,897 H251R probably damaging Het
Olfr478 A G 7: 108,031,992 I117T probably benign Het
Olfr53 C T 7: 140,652,461 H161Y probably damaging Het
Olfr625-ps1 A G 7: 103,683,200 I161V probably benign Het
Olfr640 A G 7: 104,021,529 I263T possibly damaging Het
Olfr911-ps1 A G 9: 38,524,379 T216A probably benign Het
Pcdhgb2 A T 18: 37,692,220 I755F possibly damaging Het
Pde4dip A G 3: 97,715,174 L1573P probably damaging Het
Peg3 A T 7: 6,710,651 V524E probably damaging Het
Phc1 G T 6: 122,333,370 T126N probably damaging Het
Phf1 C A 17: 26,935,317 Y169* probably null Het
Prl3a1 G A 13: 27,272,459 E99K probably damaging Het
Prss57 G A 10: 79,787,379 A78V probably damaging Het
Ptprb A T 10: 116,283,548 T196S probably benign Het
Rgsl1 A T 1: 153,826,037 C224S possibly damaging Het
Rtn4 T C 11: 29,693,274 V29A unknown Het
Selplg G A 5: 113,819,420 T275M probably damaging Het
Skint11 C T 4: 114,244,879 T363I possibly damaging Het
Slc22a29 T A 19: 8,193,487 I289F probably benign Het
Slc26a2 A G 18: 61,198,704 S552P probably benign Het
Sptb T A 12: 76,608,526 K1480* probably null Het
Sptbn1 C A 11: 30,142,153 M537I probably damaging Het
Sqor A T 2: 122,785,088 H43L probably benign Het
Srcin1 C A 11: 97,526,100 E913* probably null Het
Srgap1 A G 10: 121,785,492 L1032P probably damaging Het
Stc2 T C 11: 31,365,413 K142R probably benign Het
Stox1 A C 10: 62,659,526 N989K probably damaging Het
Tert T A 13: 73,628,195 L355H probably damaging Het
Tfb2m A G 1: 179,531,361 F319S probably damaging Het
Trps1 A G 15: 50,831,877 F341L probably damaging Het
Ttk T C 9: 83,843,679 V218A probably benign Het
Vmn1r159 A G 7: 22,843,271 I112T probably benign Het
Vps8 C A 16: 21,532,320 Q916K probably benign Het
Wdr12 A T 1: 60,082,066 D364E probably damaging Het
Ylpm1 A G 12: 85,057,268 E2019G probably damaging Het
Zfp507 A G 7: 35,794,538 L360P probably damaging Het
Other mutations in Extl3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00309:Extl3 APN 14 65076989 missense probably benign 0.08
IGL00329:Extl3 APN 14 65075621 missense probably benign 0.03
IGL00959:Extl3 APN 14 65076912 missense probably benign 0.01
IGL01321:Extl3 APN 14 65066762 missense probably benign
IGL01443:Extl3 APN 14 65077470 missense probably damaging 1.00
IGL01446:Extl3 APN 14 65077080 missense probably benign
IGL01517:Extl3 APN 14 65076707 missense probably damaging 1.00
IGL01955:Extl3 APN 14 65075966 missense probably benign
IGL02073:Extl3 APN 14 65076339 missense probably damaging 1.00
IGL02188:Extl3 APN 14 65075705 missense probably damaging 1.00
IGL02269:Extl3 APN 14 65077583 missense probably damaging 1.00
IGL02476:Extl3 APN 14 65077244 missense probably benign 0.05
IGL02961:Extl3 APN 14 65056959 missense possibly damaging 0.94
G1Funyon:Extl3 UTSW 14 65076284 missense probably damaging 0.98
R0532:Extl3 UTSW 14 65077673 missense probably benign 0.06
R0580:Extl3 UTSW 14 65075729 missense probably damaging 1.00
R1395:Extl3 UTSW 14 65077496 missense possibly damaging 0.95
R1495:Extl3 UTSW 14 65075867 missense probably benign 0.01
R1916:Extl3 UTSW 14 65077622 missense probably benign 0.20
R2409:Extl3 UTSW 14 65077568 missense probably benign 0.02
R2484:Extl3 UTSW 14 65075735 missense probably damaging 1.00
R4669:Extl3 UTSW 14 65076296 missense possibly damaging 0.56
R4764:Extl3 UTSW 14 65077320 missense probably benign 0.01
R4845:Extl3 UTSW 14 65077575 missense probably benign 0.13
R4858:Extl3 UTSW 14 65075994 missense probably benign 0.05
R5049:Extl3 UTSW 14 65076032 missense probably benign 0.00
R5439:Extl3 UTSW 14 65054626 missense probably damaging 1.00
R6196:Extl3 UTSW 14 65076135 missense probably benign
R6251:Extl3 UTSW 14 65076926 missense probably damaging 1.00
R6299:Extl3 UTSW 14 65076672 missense probably benign
R6807:Extl3 UTSW 14 65076762 missense probably damaging 1.00
R6939:Extl3 UTSW 14 65066740 missense possibly damaging 0.93
R6975:Extl3 UTSW 14 65066797 missense probably benign 0.01
R7474:Extl3 UTSW 14 65076641 missense possibly damaging 0.87
R7860:Extl3 UTSW 14 65077489 missense probably benign 0.02
R8301:Extl3 UTSW 14 65076284 missense probably damaging 0.98
R8922:Extl3 UTSW 14 65054806 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGGGTACTTATTCCGCATAGTAAAAC -3'
(R):5'- ACAGACTGTTACCGTGGCTG -3'

Sequencing Primer
(F):5'- TTATTCCGCATAGTAAAACACACTGC -3'
(R):5'- ACTGTTACCGTGGCTGGAACTC -3'
Posted On2019-12-20