Incidental Mutation 'R7846:Fgd4'
ID606646
Institutional Source Beutler Lab
Gene Symbol Fgd4
Ensembl Gene ENSMUSG00000022788
Gene NameFYVE, RhoGEF and PH domain containing 4
SynonymsFrabin-alpha, 9330209B17Rik, ZFYVE6, Frabin-gamma, Frabin-beta, Frabin
MMRRC Submission
Accession Numbers

Genbank: NM_139232; MGI: 2183747

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7846 (G1)
Quality Score225.009
Status Not validated
Chromosome16
Chromosomal Location16416917-16600549 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 16422726 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Proline at position 713 (Q713P)
Ref Sequence ENSEMBL: ENSMUSP00000125174 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069284] [ENSMUST00000161861] [ENSMUST00000162671]
Predicted Effect probably damaging
Transcript: ENSMUST00000069284
AA Change: Q713P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000069573
Gene: ENSMUSG00000022788
AA Change: Q713P

DomainStartEndE-ValueType
RhoGEF 210 392 1.48e-57 SMART
PH 423 523 1.91e-19 SMART
FYVE 551 620 2.2e-30 SMART
PH 644 742 1.31e-8 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000161861
AA Change: Q713P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000125174
Gene: ENSMUSG00000022788
AA Change: Q713P

DomainStartEndE-ValueType
RhoGEF 210 392 1.48e-57 SMART
PH 423 523 1.91e-19 SMART
FYVE 551 620 2.2e-30 SMART
PH 644 742 1.31e-8 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000162671
AA Change: Q713P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000125736
Gene: ENSMUSG00000022788
AA Change: Q713P

DomainStartEndE-ValueType
RhoGEF 210 392 1.48e-57 SMART
PH 423 523 1.91e-19 SMART
FYVE 551 620 2.2e-30 SMART
PH 644 742 1.31e-8 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: This gene is a member of the FYVE, RhoGEF and PH domain containing (FGD) family. The encoded protein is a Cdc42-specific guanine nucleotide exchange factor (GEF) that plays an essential role in regulating the actin cytoskeleton and cell morphology. Disruption of the gene in mouse causes abnormal nerve development and dysmyelination. Mutations in a similar gene in human can cause Charcot-Marie-Tooth disease type 4H (CMT4H), a disorder of the peripheral nervous system. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2014]
PHENOTYPE: Mice homozygous for a knock-out allele display dysmyelination in early peripheral nerve development, followed by severe myelin abnormalities, demyelinationn, nervous system electrophysiological deficits, and decreased grip strength at later stages. [provided by MGI curators]
Allele List at MGI

All alleles(60) : Gene trapped(60)

Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abraxas1 A G 5: 100,806,832 V247A probably damaging Het
Acot13 G T 13: 24,818,150 T103K probably damaging Het
Acsl6 A T 11: 54,361,075 I683F probably damaging Het
Acss2 A T 2: 155,561,033 H577L probably damaging Het
Ahctf1 A T 1: 179,787,073 V382D probably damaging Het
Aldob T C 4: 49,538,858 H220R probably damaging Het
Ankrd1 C T 19: 36,116,818 V169M probably damaging Het
Atp5a1 G A 18: 77,781,315 R413H possibly damaging Het
Ccdc129 A G 6: 55,978,335 Q976R possibly damaging Het
Cep76 A G 18: 67,629,905 F283L probably damaging Het
Chrna5 A T 9: 55,005,107 D397V probably benign Het
Coro7 T C 16: 4,670,536 D90G probably damaging Het
Csnk1g3 A G 18: 53,948,105 N383D probably benign Het
Cwf19l2 C A 9: 3,477,889 Q865K probably damaging Het
Cyth2 C A 7: 45,810,954 W149C probably damaging Het
D3Ertd254e C A 3: 36,165,589 T587N probably benign Het
Dgkh C A 14: 78,618,586 R349L probably damaging Het
Dnajc1 G T 2: 18,219,893 T383N possibly damaging Het
Extl3 A T 14: 65,075,732 M667K probably damaging Het
Fam149a G T 8: 45,358,641 A75E Het
Frat2 T A 19: 41,847,776 I46F probably damaging Het
Gm11639 T A 11: 104,714,745 probably null Het
Gm13023 A T 4: 143,793,993 D269V probably benign Het
Gzmc A G 14: 56,231,560 V234A probably damaging Het
H2-Q4 A G 17: 35,380,158 N135D probably damaging Het
Ighv1-85 A T 12: 116,000,317 V21D possibly damaging Het
Kcna6 A T 6: 126,739,020 V302E probably damaging Het
Kdm3b G T 18: 34,809,240 V795L possibly damaging Het
Kdm5b G A 1: 134,617,840 R913H probably damaging Het
Lpp T A 16: 24,608,126 M1K probably null Het
Med12l T C 3: 59,264,934 S1704P probably damaging Het
Mfsd10 G T 5: 34,636,112 S95* probably null Het
Napepld C T 5: 21,675,723 E225K probably benign Het
Ndfip2 T C 14: 105,298,014 F245L probably damaging Het
Oaf G A 9: 43,222,780 R215C probably damaging Het
Olfr370 A G 8: 83,541,897 H251R probably damaging Het
Olfr478 A G 7: 108,031,992 I117T probably benign Het
Olfr53 C T 7: 140,652,461 H161Y probably damaging Het
Olfr625-ps1 A G 7: 103,683,200 I161V probably benign Het
Olfr640 A G 7: 104,021,529 I263T possibly damaging Het
Olfr911-ps1 A G 9: 38,524,379 T216A probably benign Het
Pcdhgb2 A T 18: 37,692,220 I755F possibly damaging Het
Pde4dip A G 3: 97,715,174 L1573P probably damaging Het
Peg3 A T 7: 6,710,651 V524E probably damaging Het
Phc1 G T 6: 122,333,370 T126N probably damaging Het
Phf1 C A 17: 26,935,317 Y169* probably null Het
Prl3a1 G A 13: 27,272,459 E99K probably damaging Het
Prss57 G A 10: 79,787,379 A78V probably damaging Het
Ptprb A T 10: 116,283,548 T196S probably benign Het
Rgsl1 A T 1: 153,826,037 C224S possibly damaging Het
Rtn4 T C 11: 29,693,274 V29A unknown Het
Selplg G A 5: 113,819,420 T275M probably damaging Het
Skint11 C T 4: 114,244,879 T363I possibly damaging Het
Slc22a29 T A 19: 8,193,487 I289F probably benign Het
Slc26a2 A G 18: 61,198,704 S552P probably benign Het
Sptb T A 12: 76,608,526 K1480* probably null Het
Sptbn1 C A 11: 30,142,153 M537I probably damaging Het
Sqor A T 2: 122,785,088 H43L probably benign Het
Srcin1 C A 11: 97,526,100 E913* probably null Het
Srgap1 A G 10: 121,785,492 L1032P probably damaging Het
Stc2 T C 11: 31,365,413 K142R probably benign Het
Stox1 A C 10: 62,659,526 N989K probably damaging Het
Tert T A 13: 73,628,195 L355H probably damaging Het
Tfb2m A G 1: 179,531,361 F319S probably damaging Het
Trps1 A G 15: 50,831,877 F341L probably damaging Het
Ttk T C 9: 83,843,679 V218A probably benign Het
Vmn1r159 A G 7: 22,843,271 I112T probably benign Het
Vps8 C A 16: 21,532,320 Q916K probably benign Het
Wdr12 A T 1: 60,082,066 D364E probably damaging Het
Ylpm1 A G 12: 85,057,268 E2019G probably damaging Het
Zfp507 A G 7: 35,794,538 L360P probably damaging Het
Other mutations in Fgd4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01289:Fgd4 APN 16 16484303 missense probably damaging 0.99
IGL01455:Fgd4 APN 16 16490490 missense probably benign 0.22
IGL02035:Fgd4 APN 16 16490416 splice site probably benign
IGL02353:Fgd4 APN 16 16462045 missense probably damaging 0.96
IGL02360:Fgd4 APN 16 16462045 missense probably damaging 0.96
IGL03100:Fgd4 APN 16 16477519 splice site probably benign
11287:Fgd4 UTSW 16 16423923 missense probably damaging 1.00
R0787:Fgd4 UTSW 16 16423901 splice site probably benign
R0853:Fgd4 UTSW 16 16474387 splice site probably benign
R0879:Fgd4 UTSW 16 16477449 missense probably damaging 1.00
R1482:Fgd4 UTSW 16 16484473 missense probably benign 0.39
R1619:Fgd4 UTSW 16 16424056 missense possibly damaging 0.52
R1635:Fgd4 UTSW 16 16475029 nonsense probably null
R2018:Fgd4 UTSW 16 16435960 missense probably benign 0.15
R2120:Fgd4 UTSW 16 16425828 missense probably benign 0.44
R2292:Fgd4 UTSW 16 16436000 missense possibly damaging 0.95
R2902:Fgd4 UTSW 16 16425865 missense probably damaging 1.00
R4575:Fgd4 UTSW 16 16437032 missense probably damaging 1.00
R4747:Fgd4 UTSW 16 16423929 missense probably damaging 1.00
R4941:Fgd4 UTSW 16 16484538 missense probably benign
R5196:Fgd4 UTSW 16 16484142 missense probably benign 0.01
R5372:Fgd4 UTSW 16 16484291 missense probably benign 0.03
R5457:Fgd4 UTSW 16 16462009 missense probably benign 0.39
R5486:Fgd4 UTSW 16 16475037 missense probably damaging 1.00
R6709:Fgd4 UTSW 16 16484481 missense probably benign 0.09
R6962:Fgd4 UTSW 16 16484087 splice site probably null
R7207:Fgd4 UTSW 16 16484556 missense probably benign 0.11
R7732:Fgd4 UTSW 16 16484595 missense probably benign
R7749:Fgd4 UTSW 16 16475154 missense probably benign 0.02
R7937:Fgd4 UTSW 16 16469773 missense probably damaging 1.00
R8517:Fgd4 UTSW 16 16422645 missense probably benign 0.04
R8755:Fgd4 UTSW 16 16484269 missense probably benign 0.00
Z1088:Fgd4 UTSW 16 16484470 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GCAGCTGCTGAAGTTTAGCATTC -3'
(R):5'- AGCCTCCATCCAAAGAGAGTTC -3'

Sequencing Primer
(F):5'- CATTCTGACTTTTTCTTGGGTCCAGG -3'
(R):5'- TCCATCCAAAGAGAGTTCCTGAG -3'
Posted On2019-12-20