Incidental Mutation 'R7847:Trak2'
ID606660
Institutional Source Beutler Lab
Gene Symbol Trak2
Ensembl Gene ENSMUSG00000026028
Gene Nametrafficking protein, kinesin binding 2
SynonymsGRIF-1, 4733401O11Rik, GRIF1, OIP98, CALS-C, 2900022D04Rik, Als2cr3
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7847 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location58900449-58973430 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 58935818 bp
ZygosityHeterozygous
Amino Acid Change Serine to Alanine at position 72 (S72A)
Ref Sequence ENSEMBL: ENSMUSP00000027186 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027186] [ENSMUST00000173590] [ENSMUST00000174120]
Predicted Effect possibly damaging
Transcript: ENSMUST00000027186
AA Change: S72A

PolyPhen 2 Score 0.876 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000027186
Gene: ENSMUSG00000026028
AA Change: S72A

DomainStartEndE-ValueType
Pfam:HAP1_N 48 353 2.5e-135 PFAM
Pfam:Milton 426 565 3e-26 PFAM
low complexity region 663 673 N/A INTRINSIC
low complexity region 693 714 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000173590
SMART Domains Protein: ENSMUSP00000134499
Gene: ENSMUSG00000026028

DomainStartEndE-ValueType
Pfam:HAP1_N 2 52 9.4e-10 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000174120
AA Change: S72A

PolyPhen 2 Score 0.929 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000134253
Gene: ENSMUSG00000026028
AA Change: S72A

DomainStartEndE-ValueType
Pfam:HAP1_N 47 354 1.3e-129 PFAM
Pfam:Milton 411 565 1.1e-41 PFAM
Meta Mutation Damage Score 0.1708 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (45/45)
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2300002M23Rik T A 17: 35,568,652 Y296N probably benign Het
Abcc4 T C 14: 118,627,480 E378G probably damaging Het
Acp2 C T 2: 91,210,732 H422Y possibly damaging Het
Aldoart1 C T 4: 72,851,956 C205Y probably damaging Het
Alg9 T C 9: 50,789,605 L225S possibly damaging Het
Anapc1 A C 2: 128,669,908 V455G possibly damaging Het
Arhgef5 C A 6: 43,275,135 S940* probably null Het
Asb15 C A 6: 24,564,267 A240E probably damaging Het
BB014433 GCACACAGCTTTGGAGGTGTACACACCCGGGTTGGGGCCTCTACACACAGCTTTGGAGGTGTACACACCCGGGTTGGGGCCTCTGCACACAGCTTTGG GCACACAGCTTTGGAGGTGTACACACCCGGGTTGGGGCCTCTGCACACAGCTTTGG 8: 15,042,160 probably benign Het
Ccdc17 A G 4: 116,599,906 E529G probably benign Het
Cyp2b10 T C 7: 25,897,760 S26P possibly damaging Het
Dcp1b T C 6: 119,215,295 S391P probably benign Het
Dock6 A T 9: 21,801,207 L2086Q unknown Het
Ephx1 A G 1: 181,001,861 S41P probably benign Het
Erbb3 G A 10: 128,571,189 T1034M probably damaging Het
Gm17334 T A 11: 53,772,738 probably benign Het
Golgb1 A G 16: 36,931,920 H3227R probably damaging Het
Grin2c G A 11: 115,260,978 P52L possibly damaging Het
Herc2 T C 7: 56,157,560 probably null Het
Il17rb A G 14: 29,996,806 Y440H probably damaging Het
Kcng4 A G 8: 119,626,142 L343P probably damaging Het
Knl1 G A 2: 119,070,976 E1053K probably benign Het
Lipo4 A T 19: 33,514,199 V128E possibly damaging Het
Lmntd2 T C 7: 141,210,150 N650D probably benign Het
Lrrfip2 T C 9: 111,213,880 L460P probably damaging Het
Man2a2 G C 7: 80,368,865 A82G probably benign Het
Mtcl1 T C 17: 66,344,333 Q1379R probably damaging Het
Mtfr2 G A 10: 20,357,452 A256T probably benign Het
Mup17 T A 4: 61,593,219 H159L probably benign Het
Ndufaf1 A T 2: 119,660,053 D175E probably damaging Het
Nup210l A G 3: 90,151,123 M610V probably benign Het
Olfr1338 G T 4: 118,754,368 H59N possibly damaging Het
Olfr1354 T A 10: 78,916,896 S19T probably benign Het
Olfr955 A G 9: 39,470,505 S74P probably benign Het
Pard3b A G 1: 62,343,934 D729G probably benign Het
Phactr1 T C 13: 43,057,188 L169P possibly damaging Het
Rad54b T A 4: 11,612,655 S762R probably damaging Het
Senp5 C T 16: 31,990,173 V88I probably benign Het
Specc1l T C 10: 75,309,836 V1105A probably damaging Het
Ttyh2 T C 11: 114,675,674 probably null Het
Ush2a G A 1: 188,430,808 C1029Y probably damaging Het
Vmn2r17 A G 5: 109,420,197 Y62C probably damaging Het
Vmn2r41 A G 7: 8,161,548 F2L probably benign Het
Xirp1 G T 9: 120,019,753 D21E possibly damaging Het
Zfp114 C A 7: 24,181,035 Q270K possibly damaging Het
Zfp341 T C 2: 154,634,194 S441P probably damaging Het
Zfp780b A C 7: 27,964,418 H237Q probably benign Het
Other mutations in Trak2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01410:Trak2 APN 1 58923607 missense probably damaging 1.00
IGL01982:Trak2 APN 1 58926655 missense possibly damaging 0.94
IGL02154:Trak2 APN 1 58908729 missense probably damaging 1.00
IGL02399:Trak2 APN 1 58910045 missense probably benign 0.00
IGL02732:Trak2 APN 1 58910063 missense probably benign 0.19
IGL02734:Trak2 APN 1 58910063 missense probably benign 0.19
IGL03147:Trak2 UTSW 1 58910063 missense probably benign 0.19
P0041:Trak2 UTSW 1 58909964 missense probably damaging 1.00
R0079:Trak2 UTSW 1 58926724 missense probably damaging 1.00
R0791:Trak2 UTSW 1 58903661 missense probably benign
R0792:Trak2 UTSW 1 58903661 missense probably benign
R1099:Trak2 UTSW 1 58921841 missense probably benign 0.05
R1899:Trak2 UTSW 1 58946336 start codon destroyed probably null 0.98
R1903:Trak2 UTSW 1 58918855 splice site probably null
R2292:Trak2 UTSW 1 58935757 missense probably damaging 0.99
R2312:Trak2 UTSW 1 58935782 missense probably damaging 1.00
R3720:Trak2 UTSW 1 58946245 critical splice donor site probably null
R4966:Trak2 UTSW 1 58919321 missense probably damaging 1.00
R5088:Trak2 UTSW 1 58935808 missense probably benign 0.06
R5730:Trak2 UTSW 1 58921807 missense probably damaging 1.00
R5840:Trak2 UTSW 1 58919273 missense probably damaging 1.00
R5981:Trak2 UTSW 1 58908690 missense probably benign 0.01
R6000:Trak2 UTSW 1 58911812 missense possibly damaging 0.71
R6053:Trak2 UTSW 1 58904069 missense possibly damaging 0.62
R6894:Trak2 UTSW 1 58911733 missense probably damaging 1.00
R6916:Trak2 UTSW 1 58910025 missense probably benign 0.06
R7096:Trak2 UTSW 1 58903590 missense probably damaging 1.00
R7544:Trak2 UTSW 1 58921068 splice site probably null
R7889:Trak2 UTSW 1 58918824 missense probably damaging 1.00
R8039:Trak2 UTSW 1 58946288 missense probably benign 0.16
R8313:Trak2 UTSW 1 58921147 nonsense probably null
X0067:Trak2 UTSW 1 58908532 missense probably benign 0.18
Predicted Primers PCR Primer
(F):5'- GGTGAACACTGAACAATGGCTAC -3'
(R):5'- TGGTTGCCTACTTTCAAAGAAC -3'

Sequencing Primer
(F):5'- CACTGAACAATGGCTACTAAATGCTG -3'
(R):5'- CACTACAGCTTGATAAGTGGAAC -3'
Posted On2019-12-20