Mutagenetix > Incidental Mutations

Incidental Mutation 'R7847:Ephx1'

606662

Institutional Source

Beutler Lab

Gene Symbol

Ephx1

Ensembl Gene

ENSMUSG00000038776

Gene Name

epoxide hydrolase 1, microsomal

Synonyms

Eph-1, mEH, Eph1

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.106) question?

Stock #

R7847 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

180976210-181020904 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 181001861 bp

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 41 (S41P)

Ref Sequence

ENSEMBL: ENSMUSP00000047551 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000036928] [ENSMUST00000111068] [ENSMUST00000147585]

Predicted Effect

probably benign
Transcript: ENSMUST00000036928
AA Change: S41P

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000047551
Gene: ENSMUSG00000038776
AA Change: S41P

Domain	Start	End	E-Value	Type
Pfam:EHN	50	160	2.1e-36	PFAM
Pfam:Abhydrolase_1	142	404	2.1e-28	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000111068
AA Change: S41P

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000106697
Gene: ENSMUSG00000038776
AA Change: S41P

Domain	Start	End	E-Value	Type
Pfam:EHN	49	161	4.2e-38	PFAM
Pfam:Abhydrolase_6	144	430	3.7e-10	PFAM
Pfam:Abhydrolase_1	178	254	1.6e-11	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000147585
AA Change: S41P

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000122671
Gene: ENSMUSG00000038776
AA Change: S41P

Domain	Start	End	E-Value	Type
Pfam:EHN	49	130	2.6e-26	PFAM

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.2%

Validation Efficiency

100% (45/45)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Epoxide hydrolase is a critical biotransformation enzyme that converts epoxides from the degradation of aromatic compounds to trans-dihydrodiols which can be conjugated and excreted from the body. Epoxide hydrolase functions in both the activation and detoxification of epoxides. Mutations in this gene cause preeclampsia, epoxide hydrolase deficiency or increased epoxide hydrolase activity. Alternatively spliced transcript variants encoding the same protein have been found for this gene.[provided by RefSeq, Dec 2008]
PHENOTYPE: Mice homozygous for a knock-out allele are highly resistant to DMBA-induced skin carcinogenesis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 47 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2300002M23Rik	T	A	17: 35,568,652	Y296N	probably benign	Het
Abcc4	T	C	14: 118,627,480	E378G	probably damaging	Het
Acp2	C	T	2: 91,210,732	H422Y	possibly damaging	Het
Aldoart1	C	T	4: 72,851,956	C205Y	probably damaging	Het
Alg9	T	C	9: 50,789,605	L225S	possibly damaging	Het
Anapc1	A	C	2: 128,669,908	V455G	possibly damaging	Het
Arhgef5	C	A	6: 43,275,135	S940*	probably null	Het
Asb15	C	A	6: 24,564,267	A240E	probably damaging	Het
BB014433	GCACACAGCTTTGGAGGTGTACACACCCGGGTTGGGGCCTCTACACACAGCTTTGGAGGTGTACACACCCGGGTTGGGGCCTCTGCACACAGCTTTGG	GCACACAGCTTTGGAGGTGTACACACCCGGGTTGGGGCCTCTGCACACAGCTTTGG	8: 15,042,160		probably benign	Het
Ccdc17	A	G	4: 116,599,906	E529G	probably benign	Het
Cyp2b10	T	C	7: 25,897,760	S26P	possibly damaging	Het
Dcp1b	T	C	6: 119,215,295	S391P	probably benign	Het
Dock6	A	T	9: 21,801,207	L2086Q	unknown	Het
Erbb3	G	A	10: 128,571,189	T1034M	probably damaging	Het
Gm17334	T	A	11: 53,772,738		probably benign	Het
Golgb1	A	G	16: 36,931,920	H3227R	probably damaging	Het
Grin2c	G	A	11: 115,260,978	P52L	possibly damaging	Het
Herc2	T	C	7: 56,157,560		probably null	Het
Il17rb	A	G	14: 29,996,806	Y440H	probably damaging	Het
Kcng4	A	G	8: 119,626,142	L343P	probably damaging	Het
Knl1	G	A	2: 119,070,976	E1053K	probably benign	Het
Lipo4	A	T	19: 33,514,199	V128E	possibly damaging	Het
Lmntd2	T	C	7: 141,210,150	N650D	probably benign	Het
Lrrfip2	T	C	9: 111,213,880	L460P	probably damaging	Het
Man2a2	G	C	7: 80,368,865	A82G	probably benign	Het
Mtcl1	T	C	17: 66,344,333	Q1379R	probably damaging	Het
Mtfr2	G	A	10: 20,357,452	A256T	probably benign	Het
Mup17	T	A	4: 61,593,219	H159L	probably benign	Het
Ndufaf1	A	T	2: 119,660,053	D175E	probably damaging	Het
Nup210l	A	G	3: 90,151,123	M610V	probably benign	Het
Olfr1338	G	T	4: 118,754,368	H59N	possibly damaging	Het
Olfr1354	T	A	10: 78,916,896	S19T	probably benign	Het
Olfr955	A	G	9: 39,470,505	S74P	probably benign	Het
Pard3b	A	G	1: 62,343,934	D729G	probably benign	Het
Phactr1	T	C	13: 43,057,188	L169P	possibly damaging	Het
Rad54b	T	A	4: 11,612,655	S762R	probably damaging	Het
Senp5	C	T	16: 31,990,173	V88I	probably benign	Het
Specc1l	T	C	10: 75,309,836	V1105A	probably damaging	Het
Trak2	A	C	1: 58,935,818	S72A	possibly damaging	Het
Ttyh2	T	C	11: 114,675,674		probably null	Het
Ush2a	G	A	1: 188,430,808	C1029Y	probably damaging	Het
Vmn2r17	A	G	5: 109,420,197	Y62C	probably damaging	Het
Vmn2r41	A	G	7: 8,161,548	F2L	probably benign	Het
Xirp1	G	T	9: 120,019,753	D21E	possibly damaging	Het
Zfp114	C	A	7: 24,181,035	Q270K	possibly damaging	Het
Zfp341	T	C	2: 154,634,194	S441P	probably damaging	Het
Zfp780b	A	C	7: 27,964,418	H237Q	probably benign	Het

Other mutations in Ephx1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00820:Ephx1	APN	1	180999821	missense	possibly damaging	0.82
IGL00864:Ephx1	APN	1	180990451	missense	probably damaging	1.00
IGL00972:Ephx1	APN	1	180999800	missense	probably benign	0.02
IGL01577:Ephx1	APN	1	181001980	start codon destroyed	probably null	0.96
IGL02718:Ephx1	APN	1	180999786	missense	probably damaging	1.00
IGL03330:Ephx1	APN	1	180999806	missense	possibly damaging	0.53
R1190:Ephx1	UTSW	1	180993929	missense	probably benign	0.24
R1751:Ephx1	UTSW	1	180994677	missense	probably damaging	1.00
R1767:Ephx1	UTSW	1	180994677	missense	probably damaging	1.00
R2437:Ephx1	UTSW	1	180996096	missense	probably damaging	1.00
R2484:Ephx1	UTSW	1	180989972	missense	probably damaging	1.00
R3623:Ephx1	UTSW	1	180989933	missense	probably benign	0.35
R3696:Ephx1	UTSW	1	180989951	missense	probably benign	0.03
R4674:Ephx1	UTSW	1	180994691	missense	probably damaging	1.00
R4675:Ephx1	UTSW	1	180994691	missense	probably damaging	1.00
R4769:Ephx1	UTSW	1	180995978	missense	possibly damaging	0.62
R4883:Ephx1	UTSW	1	181001923	missense	possibly damaging	0.76
R6827:Ephx1	UTSW	1	180989888	missense	probably damaging	1.00
R6974:Ephx1	UTSW	1	180999722	critical splice donor site	probably null
R7147:Ephx1	UTSW	1	181001819	missense	probably damaging	0.96
Z1177:Ephx1	UTSW	1	180999769	missense	possibly damaging	0.94

Predicted Primers

PCR Primer
(F):5'- ATGCACATGACCTCAGGGAG -3'
(R):5'- ACTTGCATCCCTAGCAAGC -3'

Sequencing Primer
(F):5'- GGAAACCTCAGGATGTTCCATTTC -3'
(R):5'- TAGCAAGCCAGGCACCAGG -3'

Posted On

2019-12-20