Incidental Mutation 'R7847:Ephx1'
ID 606662
Institutional Source Beutler Lab
Gene Symbol Ephx1
Ensembl Gene ENSMUSG00000038776
Gene Name epoxide hydrolase 1, microsomal
Synonyms Eph-1, mEH, Eph1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.108) question?
Stock # R7847 (G1)
Quality Score 225.009
Status Validated
Chromosome 1
Chromosomal Location 180976210-181020904 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 181001861 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 41 (S41P)
Ref Sequence ENSEMBL: ENSMUSP00000047551 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036928] [ENSMUST00000111068] [ENSMUST00000147585]
AlphaFold Q9D379
Predicted Effect probably benign
Transcript: ENSMUST00000036928
AA Change: S41P

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000047551
Gene: ENSMUSG00000038776
AA Change: S41P

DomainStartEndE-ValueType
Pfam:EHN 50 160 2.1e-36 PFAM
Pfam:Abhydrolase_1 142 404 2.1e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111068
AA Change: S41P

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000106697
Gene: ENSMUSG00000038776
AA Change: S41P

DomainStartEndE-ValueType
Pfam:EHN 49 161 4.2e-38 PFAM
Pfam:Abhydrolase_6 144 430 3.7e-10 PFAM
Pfam:Abhydrolase_1 178 254 1.6e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000147585
AA Change: S41P

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000122671
Gene: ENSMUSG00000038776
AA Change: S41P

DomainStartEndE-ValueType
Pfam:EHN 49 130 2.6e-26 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (45/45)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Epoxide hydrolase is a critical biotransformation enzyme that converts epoxides from the degradation of aromatic compounds to trans-dihydrodiols which can be conjugated and excreted from the body. Epoxide hydrolase functions in both the activation and detoxification of epoxides. Mutations in this gene cause preeclampsia, epoxide hydrolase deficiency or increased epoxide hydrolase activity. Alternatively spliced transcript variants encoding the same protein have been found for this gene.[provided by RefSeq, Dec 2008]
PHENOTYPE: Mice homozygous for a knock-out allele are highly resistant to DMBA-induced skin carcinogenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2300002M23Rik T A 17: 35,568,652 Y296N probably benign Het
Abcc4 T C 14: 118,627,480 E378G probably damaging Het
Acp2 C T 2: 91,210,732 H422Y possibly damaging Het
Aldoart1 C T 4: 72,851,956 C205Y probably damaging Het
Alg9 T C 9: 50,789,605 L225S possibly damaging Het
Anapc1 A C 2: 128,669,908 V455G possibly damaging Het
Arhgef5 C A 6: 43,275,135 S940* probably null Het
Asb15 C A 6: 24,564,267 A240E probably damaging Het
BB014433 GCACACAGCTTTGGAGGTGTACACACCCGGGTTGGGGCCTCTACACACAGCTTTGGAGGTGTACACACCCGGGTTGGGGCCTCTGCACACAGCTTTGG GCACACAGCTTTGGAGGTGTACACACCCGGGTTGGGGCCTCTGCACACAGCTTTGG 8: 15,042,160 probably benign Het
Ccdc17 A G 4: 116,599,906 E529G probably benign Het
Cyp2b10 T C 7: 25,897,760 S26P possibly damaging Het
Dcp1b T C 6: 119,215,295 S391P probably benign Het
Dock6 A T 9: 21,801,207 L2086Q unknown Het
Erbb3 G A 10: 128,571,189 T1034M probably damaging Het
Gm17334 T A 11: 53,772,738 probably benign Het
Golgb1 A G 16: 36,931,920 H3227R probably damaging Het
Grin2c G A 11: 115,260,978 P52L possibly damaging Het
Herc2 T C 7: 56,157,560 probably null Het
Il17rb A G 14: 29,996,806 Y440H probably damaging Het
Kcng4 A G 8: 119,626,142 L343P probably damaging Het
Knl1 G A 2: 119,070,976 E1053K probably benign Het
Lipo4 A T 19: 33,514,199 V128E possibly damaging Het
Lmntd2 T C 7: 141,210,150 N650D probably benign Het
Lrrfip2 T C 9: 111,213,880 L460P probably damaging Het
Man2a2 G C 7: 80,368,865 A82G probably benign Het
Mtcl1 T C 17: 66,344,333 Q1379R probably damaging Het
Mtfr2 G A 10: 20,357,452 A256T probably benign Het
Mup17 T A 4: 61,593,219 H159L probably benign Het
Ndufaf1 A T 2: 119,660,053 D175E probably damaging Het
Nup210l A G 3: 90,151,123 M610V probably benign Het
Olfr1338 G T 4: 118,754,368 H59N possibly damaging Het
Olfr1354 T A 10: 78,916,896 S19T probably benign Het
Olfr955 A G 9: 39,470,505 S74P probably benign Het
Pard3b A G 1: 62,343,934 D729G probably benign Het
Phactr1 T C 13: 43,057,188 L169P possibly damaging Het
Rad54b T A 4: 11,612,655 S762R probably damaging Het
Senp5 C T 16: 31,990,173 V88I probably benign Het
Specc1l T C 10: 75,309,836 V1105A probably damaging Het
Trak2 A C 1: 58,935,818 S72A possibly damaging Het
Ttyh2 T C 11: 114,675,674 probably null Het
Ush2a G A 1: 188,430,808 C1029Y probably damaging Het
Vmn2r17 A G 5: 109,420,197 Y62C probably damaging Het
Vmn2r41 A G 7: 8,161,548 F2L probably benign Het
Xirp1 G T 9: 120,019,753 D21E possibly damaging Het
Zfp114 C A 7: 24,181,035 Q270K possibly damaging Het
Zfp341 T C 2: 154,634,194 S441P probably damaging Het
Zfp780b A C 7: 27,964,418 H237Q probably benign Het
Other mutations in Ephx1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00820:Ephx1 APN 1 180999821 missense possibly damaging 0.82
IGL00864:Ephx1 APN 1 180990451 missense probably damaging 1.00
IGL00972:Ephx1 APN 1 180999800 missense probably benign 0.02
IGL01577:Ephx1 APN 1 181001980 start codon destroyed probably null 0.96
IGL02718:Ephx1 APN 1 180999786 missense probably damaging 1.00
IGL03330:Ephx1 APN 1 180999806 missense possibly damaging 0.53
R1190:Ephx1 UTSW 1 180993929 missense probably benign 0.24
R1751:Ephx1 UTSW 1 180994677 missense probably damaging 1.00
R1767:Ephx1 UTSW 1 180994677 missense probably damaging 1.00
R2437:Ephx1 UTSW 1 180996096 missense probably damaging 1.00
R2484:Ephx1 UTSW 1 180989972 missense probably damaging 1.00
R3623:Ephx1 UTSW 1 180989933 missense probably benign 0.35
R3696:Ephx1 UTSW 1 180989951 missense probably benign 0.03
R4674:Ephx1 UTSW 1 180994691 missense probably damaging 1.00
R4675:Ephx1 UTSW 1 180994691 missense probably damaging 1.00
R4769:Ephx1 UTSW 1 180995978 missense possibly damaging 0.62
R4883:Ephx1 UTSW 1 181001923 missense possibly damaging 0.76
R6827:Ephx1 UTSW 1 180989888 missense probably damaging 1.00
R6974:Ephx1 UTSW 1 180999722 critical splice donor site probably null
R7147:Ephx1 UTSW 1 181001819 missense probably damaging 0.96
R9598:Ephx1 UTSW 1 180999816 nonsense probably null
Z1177:Ephx1 UTSW 1 180999769 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- ATGCACATGACCTCAGGGAG -3'
(R):5'- ACTTGCATCCCTAGCAAGC -3'

Sequencing Primer
(F):5'- GGAAACCTCAGGATGTTCCATTTC -3'
(R):5'- TAGCAAGCCAGGCACCAGG -3'
Posted On 2019-12-20