Incidental Mutation 'R7847:Acp2'
ID606664
Institutional Source Beutler Lab
Gene Symbol Acp2
Ensembl Gene ENSMUSG00000002103
Gene Nameacid phosphatase 2, lysosomal
SynonymsAcp-2, LAP
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.772) question?
Stock #R7847 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location91202885-91214098 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 91210732 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Tyrosine at position 422 (H422Y)
Ref Sequence ENSEMBL: ENSMUSP00000002172 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002172] [ENSMUST00000028696] [ENSMUST00000111352] [ENSMUST00000150403] [ENSMUST00000155418]
Predicted Effect possibly damaging
Transcript: ENSMUST00000002172
AA Change: H422Y

PolyPhen 2 Score 0.665 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000002172
Gene: ENSMUSG00000002103
AA Change: H422Y

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
Pfam:His_Phos_2 54 330 1.5e-35 PFAM
transmembrane domain 382 404 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000028696
SMART Domains Protein: ENSMUSP00000028696
Gene: ENSMUSG00000002109

DomainStartEndE-ValueType
low complexity region 48 69 N/A INTRINSIC
WD40 100 140 1.48e-2 SMART
WD40 144 185 7.92e1 SMART
WD40 187 229 7.36e1 SMART
WD40 231 271 3.14e-6 SMART
WD40 278 316 3.55e-5 SMART
Blast:WD40 379 419 1e-14 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000111352
SMART Domains Protein: ENSMUSP00000106984
Gene: ENSMUSG00000002109

DomainStartEndE-ValueType
WD40 8 49 7.92e1 SMART
WD40 51 93 7.36e1 SMART
WD40 95 135 3.14e-6 SMART
WD40 142 180 3.55e-5 SMART
Blast:WD40 243 283 3e-14 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000150403
SMART Domains Protein: ENSMUSP00000119144
Gene: ENSMUSG00000002103

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
Pfam:His_Phos_2 32 159 4e-35 PFAM
Pfam:His_Phos_2 147 297 5.1e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000155418
SMART Domains Protein: ENSMUSP00000116030
Gene: ENSMUSG00000002103

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
Pfam:His_Phos_2 32 166 4e-33 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (45/45)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the beta subunit of lysosomal acid phosphatase (LAP). LAP is chemically and genetically distinct from red cell acid phosphatase. The encoded protein belongs to a family of distinct isoenzymes which hydrolyze orthophosphoric monoesters to alcohol and phosphate. LAP-deficiencies in mice cause multiple defects including bone structure alterations, lysosomal storage defects in the kidneys and central nervous system, and an increased tendency towards seizures. An enzymatically-inactive allele of LAP in mice exhibited a more severe phenotype than the null allele, and defects included cerebellum abnormalities, growth retardation, hair-follicle abnormalities, and an ataxia-like phenotype. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Oct 2014]
PHENOTYPE: Homozygous mutation of this gene result in skeletal defects and a small percentage of mutant animals exhibit tonic-clonic seizures. Mice with a missense mutation (Gly244Glu) are growth retarded and exhibit a disrupted cerebellum cytoarchitecture, an abnormal hair shaft, and skin malformations. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2300002M23Rik T A 17: 35,568,652 Y296N probably benign Het
Abcc4 T C 14: 118,627,480 E378G probably damaging Het
Aldoart1 C T 4: 72,851,956 C205Y probably damaging Het
Alg9 T C 9: 50,789,605 L225S possibly damaging Het
Anapc1 A C 2: 128,669,908 V455G possibly damaging Het
Arhgef5 C A 6: 43,275,135 S940* probably null Het
Asb15 C A 6: 24,564,267 A240E probably damaging Het
BB014433 GCACACAGCTTTGGAGGTGTACACACCCGGGTTGGGGCCTCTACACACAGCTTTGGAGGTGTACACACCCGGGTTGGGGCCTCTGCACACAGCTTTGG GCACACAGCTTTGGAGGTGTACACACCCGGGTTGGGGCCTCTGCACACAGCTTTGG 8: 15,042,160 probably benign Het
Ccdc17 A G 4: 116,599,906 E529G probably benign Het
Cyp2b10 T C 7: 25,897,760 S26P possibly damaging Het
Dcp1b T C 6: 119,215,295 S391P probably benign Het
Dock6 A T 9: 21,801,207 L2086Q unknown Het
Ephx1 A G 1: 181,001,861 S41P probably benign Het
Erbb3 G A 10: 128,571,189 T1034M probably damaging Het
Gm17334 T A 11: 53,772,738 probably benign Het
Golgb1 A G 16: 36,931,920 H3227R probably damaging Het
Grin2c G A 11: 115,260,978 P52L possibly damaging Het
Herc2 T C 7: 56,157,560 probably null Het
Il17rb A G 14: 29,996,806 Y440H probably damaging Het
Kcng4 A G 8: 119,626,142 L343P probably damaging Het
Knl1 G A 2: 119,070,976 E1053K probably benign Het
Lipo4 A T 19: 33,514,199 V128E possibly damaging Het
Lmntd2 T C 7: 141,210,150 N650D probably benign Het
Lrrfip2 T C 9: 111,213,880 L460P probably damaging Het
Man2a2 G C 7: 80,368,865 A82G probably benign Het
Mtcl1 T C 17: 66,344,333 Q1379R probably damaging Het
Mtfr2 G A 10: 20,357,452 A256T probably benign Het
Mup17 T A 4: 61,593,219 H159L probably benign Het
Ndufaf1 A T 2: 119,660,053 D175E probably damaging Het
Nup210l A G 3: 90,151,123 M610V probably benign Het
Olfr1338 G T 4: 118,754,368 H59N possibly damaging Het
Olfr1354 T A 10: 78,916,896 S19T probably benign Het
Olfr955 A G 9: 39,470,505 S74P probably benign Het
Pard3b A G 1: 62,343,934 D729G probably benign Het
Phactr1 T C 13: 43,057,188 L169P possibly damaging Het
Rad54b T A 4: 11,612,655 S762R probably damaging Het
Senp5 C T 16: 31,990,173 V88I probably benign Het
Specc1l T C 10: 75,309,836 V1105A probably damaging Het
Trak2 A C 1: 58,935,818 S72A possibly damaging Het
Ttyh2 T C 11: 114,675,674 probably null Het
Ush2a G A 1: 188,430,808 C1029Y probably damaging Het
Vmn2r17 A G 5: 109,420,197 Y62C probably damaging Het
Vmn2r41 A G 7: 8,161,548 F2L probably benign Het
Xirp1 G T 9: 120,019,753 D21E possibly damaging Het
Zfp114 C A 7: 24,181,035 Q270K possibly damaging Het
Zfp341 T C 2: 154,634,194 S441P probably damaging Het
Zfp780b A C 7: 27,964,418 H237Q probably benign Het
Other mutations in Acp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02137:Acp2 APN 2 91203683 missense probably damaging 1.00
IGL02251:Acp2 APN 2 91208333 unclassified probably null
IGL02445:Acp2 APN 2 91206261 missense possibly damaging 0.63
IGL02952:Acp2 APN 2 91208443 unclassified probably benign
IGL03272:Acp2 APN 2 91204233 splice site probably benign
BB008:Acp2 UTSW 2 91206715 critical splice acceptor site probably null
BB018:Acp2 UTSW 2 91206715 critical splice acceptor site probably null
R0781:Acp2 UTSW 2 91208422 unclassified probably null
R1110:Acp2 UTSW 2 91208422 unclassified probably null
R2107:Acp2 UTSW 2 91203595 splice site probably benign
R4382:Acp2 UTSW 2 91208109 missense possibly damaging 0.80
R4726:Acp2 UTSW 2 91204277 missense probably damaging 1.00
R4737:Acp2 UTSW 2 91210723 missense probably benign 0.26
R4793:Acp2 UTSW 2 91206789 missense probably benign 0.13
R4817:Acp2 UTSW 2 91203618 missense probably damaging 1.00
R5089:Acp2 UTSW 2 91211922 unclassified probably benign
R5092:Acp2 UTSW 2 91208046 missense probably benign 0.19
R5468:Acp2 UTSW 2 91206098 missense probably benign
R7931:Acp2 UTSW 2 91206715 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- AAGCCTGTTCTCCTATCAGATGTG -3'
(R):5'- ATGAAGATGGTGAGCCCCAG -3'

Sequencing Primer
(F):5'- CTGGAACTCACTTTGTAGACCAGG -3'
(R):5'- GGTGAGCCCCAGGTGCC -3'
Posted On2019-12-20