Mutagenetix > Incidental Mutation

Incidental Mutation 'R7847:Knl1'

606665

Institutional Source

Beutler Lab

Gene Symbol

Knl1

Ensembl Gene

ENSMUSG00000027326

Gene Name

kinetochore scaffold 1

Synonyms

2310043D08Rik, 5730505K17Rik

MMRRC Submission

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R7847 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

119047119-119105501 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 119070976 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Lysine at position 1053 (E1053K)

Ref Sequence

ENSEMBL: ENSMUSP00000028799 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000028799] [ENSMUST00000028802] [ENSMUST00000099542] [ENSMUST00000152380]

AlphaFold

Q66JQ7

Predicted Effect

probably benign
Transcript: ENSMUST00000028799
AA Change: E1053K

PolyPhen 2 Score 0.018 (Sensitivity: 0.95; Specificity: 0.80)

SMART Domains

Protein: ENSMUSP00000028799
Gene: ENSMUSG00000027326
AA Change: E1053K

Domain	Start	End	E-Value	Type
low complexity region	49	58	N/A	INTRINSIC
PDB:4A1G\|H	126	175	1e-13	PDB
low complexity region	426	433	N/A	INTRINSIC
low complexity region	883	894	N/A	INTRINSIC
low complexity region	1148	1159	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000028802
AA Change: E1053K

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)

SMART Domains

Protein: ENSMUSP00000028802
Gene: ENSMUSG00000027326
AA Change: E1053K

Domain	Start	End	E-Value	Type
low complexity region	49	58	N/A	INTRINSIC
internal_repeat_1	98	304	1.57e-6	PROSPERO
low complexity region	426	433	N/A	INTRINSIC
internal_repeat_1	610	824	1.57e-6	PROSPERO
low complexity region	883	894	N/A	INTRINSIC
low complexity region	1148	1159	N/A	INTRINSIC
low complexity region	1621	1644	N/A	INTRINSIC
coiled coil region	1724	1755	N/A	INTRINSIC
low complexity region	1836	1850	N/A	INTRINSIC
low complexity region	1864	1878	N/A	INTRINSIC
PDB:4NF9\|B	1899	2119	1e-115	PDB

Predicted Effect

probably benign
Transcript: ENSMUST00000099542
AA Change: E1053K

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)

SMART Domains

Protein: ENSMUSP00000097140
Gene: ENSMUSG00000027326
AA Change: E1053K

Domain	Start	End	E-Value	Type
low complexity region	49	58	N/A	INTRINSIC
internal_repeat_1	98	304	1.57e-6	PROSPERO
low complexity region	426	433	N/A	INTRINSIC
internal_repeat_1	610	824	1.57e-6	PROSPERO
low complexity region	883	894	N/A	INTRINSIC
low complexity region	1148	1159	N/A	INTRINSIC
low complexity region	1621	1644	N/A	INTRINSIC
coiled coil region	1724	1755	N/A	INTRINSIC
low complexity region	1836	1850	N/A	INTRINSIC
low complexity region	1864	1878	N/A	INTRINSIC
PDB:4NF9\|B	1899	2119	1e-115	PDB

Predicted Effect

probably benign
Transcript: ENSMUST00000152380

SMART Domains

Protein: ENSMUSP00000118646
Gene: ENSMUSG00000027326

Domain	Start	End	E-Value	Type
low complexity region	49	58	N/A	INTRINSIC
PDB:4A1G\|H	126	175	3e-14	PDB
low complexity region	426	433	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.2%

Validation Efficiency

100% (45/45)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a component of the multiprotein assembly that is required for creation of kinetochore-microtubule attachments and chromosome segregation. The encoded protein functions as a scaffold for proteins that influence the spindle assembly checkpoint during the eukaryotic cell cycle and it interacts with at least five different kinetochore proteins and two checkpoint kinases. In adults, this gene is predominantly expressed in normal testes, various cancer cell lines and primary tumors from other tissues and is ubiquitously expressed in fetal tissues. This gene was originally identified as a fusion partner with the mixed-lineage leukemia (MLL) gene in t(11;15)(q23;q14). Mutations in this gene cause autosomal recessive primary microcephaly-4 (MCPH4). Alternative splicing results in multiple transcript variants encoding different isoforms. Additional splice variants have been described but their biological validity has not been confirmed. [provided by RefSeq, Jan 2013]
PHENOTYPE: Mice homozygous for a transgenic gene disruption exhibit embryonic lethality at E6. Mice homozygous for an ENU-induced allele exhibit possible embryonic lethality. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 47 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2300002M23Rik	T	A	17: 35,568,652	Y296N	probably benign	Het
Abcc4	T	C	14: 118,627,480	E378G	probably damaging	Het
Acp2	C	T	2: 91,210,732	H422Y	possibly damaging	Het
Aldoart1	C	T	4: 72,851,956	C205Y	probably damaging	Het
Alg9	T	C	9: 50,789,605	L225S	possibly damaging	Het
Anapc1	A	C	2: 128,669,908	V455G	possibly damaging	Het
Arhgef5	C	A	6: 43,275,135	S940*	probably null	Het
Asb15	C	A	6: 24,564,267	A240E	probably damaging	Het
BB014433	GCACACAGCTTTGGAGGTGTACACACCCGGGTTGGGGCCTCTACACACAGCTTTGGAGGTGTACACACCCGGGTTGGGGCCTCTGCACACAGCTTTGG	GCACACAGCTTTGGAGGTGTACACACCCGGGTTGGGGCCTCTGCACACAGCTTTGG	8: 15,042,160		probably benign	Het
Ccdc17	A	G	4: 116,599,906	E529G	probably benign	Het
Cyp2b10	T	C	7: 25,897,760	S26P	possibly damaging	Het
Dcp1b	T	C	6: 119,215,295	S391P	probably benign	Het
Dock6	A	T	9: 21,801,207	L2086Q	unknown	Het
Ephx1	A	G	1: 181,001,861	S41P	probably benign	Het
Erbb3	G	A	10: 128,571,189	T1034M	probably damaging	Het
Gm17334	T	A	11: 53,772,738		probably benign	Het
Golgb1	A	G	16: 36,931,920	H3227R	probably damaging	Het
Grin2c	G	A	11: 115,260,978	P52L	possibly damaging	Het
Herc2	T	C	7: 56,157,560		probably null	Het
Il17rb	A	G	14: 29,996,806	Y440H	probably damaging	Het
Kcng4	A	G	8: 119,626,142	L343P	probably damaging	Het
Lipo4	A	T	19: 33,514,199	V128E	possibly damaging	Het
Lmntd2	T	C	7: 141,210,150	N650D	probably benign	Het
Lrrfip2	T	C	9: 111,213,880	L460P	probably damaging	Het
Man2a2	G	C	7: 80,368,865	A82G	probably benign	Het
Mtcl1	T	C	17: 66,344,333	Q1379R	probably damaging	Het
Mtfr2	G	A	10: 20,357,452	A256T	probably benign	Het
Mup17	T	A	4: 61,593,219	H159L	probably benign	Het
Ndufaf1	A	T	2: 119,660,053	D175E	probably damaging	Het
Nup210l	A	G	3: 90,151,123	M610V	probably benign	Het
Olfr1338	G	T	4: 118,754,368	H59N	possibly damaging	Het
Olfr1354	T	A	10: 78,916,896	S19T	probably benign	Het
Olfr955	A	G	9: 39,470,505	S74P	probably benign	Het
Pard3b	A	G	1: 62,343,934	D729G	probably benign	Het
Phactr1	T	C	13: 43,057,188	L169P	possibly damaging	Het
Rad54b	T	A	4: 11,612,655	S762R	probably damaging	Het
Senp5	C	T	16: 31,990,173	V88I	probably benign	Het
Specc1l	T	C	10: 75,309,836	V1105A	probably damaging	Het
Trak2	A	C	1: 58,935,818	S72A	possibly damaging	Het
Ttyh2	T	C	11: 114,675,674		probably null	Het
Ush2a	G	A	1: 188,430,808	C1029Y	probably damaging	Het
Vmn2r17	A	G	5: 109,420,197	Y62C	probably damaging	Het
Vmn2r41	A	G	7: 8,161,548	F2L	probably benign	Het
Xirp1	G	T	9: 120,019,753	D21E	possibly damaging	Het
Zfp114	C	A	7: 24,181,035	Q270K	possibly damaging	Het
Zfp341	T	C	2: 154,634,194	S441P	probably damaging	Het
Zfp780b	A	C	7: 27,964,418	H237Q	probably benign	Het

Other mutations in Knl1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00272:Knl1	APN	2	119064083	missense	probably damaging	0.96
IGL00582:Knl1	APN	2	119102499	missense	probably benign	0.19
IGL00666:Knl1	APN	2	119070464	missense	probably damaging	0.96
IGL01062:Knl1	APN	2	119076980	missense	probably benign	0.33
IGL01395:Knl1	APN	2	119071566	missense	probably damaging	0.96
IGL01604:Knl1	APN	2	119070001	missense	probably damaging	1.00
IGL01996:Knl1	APN	2	119104061	missense	probably damaging	1.00
IGL02086:Knl1	APN	2	119100774	missense	probably benign	0.40
IGL02105:Knl1	APN	2	119071808	missense	probably benign
IGL02106:Knl1	APN	2	119072008	missense	possibly damaging	0.89
IGL02201:Knl1	APN	2	119069152	missense	probably benign	0.01
IGL02252:Knl1	APN	2	119072540	missense	probably damaging	1.00
IGL02414:Knl1	APN	2	119070323	missense	possibly damaging	0.83
IGL02655:Knl1	APN	2	119070992	missense	possibly damaging	0.62
IGL02682:Knl1	APN	2	119077969	missense	possibly damaging	0.86
IGL02710:Knl1	APN	2	119070930	missense	probably damaging	0.99
IGL02877:Knl1	APN	2	119088831	missense	probably benign	0.08
IGL03100:Knl1	APN	2	119100770	missense	probably damaging	0.99
IGL03210:Knl1	APN	2	119070617	missense	probably benign	0.02
IGL03138:Knl1	UTSW	2	119072359	missense	probably damaging	0.96
R0023:Knl1	UTSW	2	119102549	missense	possibly damaging	0.73
R0064:Knl1	UTSW	2	119076243	missense	probably benign	0.00
R0064:Knl1	UTSW	2	119076243	missense	probably benign	0.00
R0078:Knl1	UTSW	2	119069892	missense	probably benign	0.16
R0178:Knl1	UTSW	2	119058405	splice site	probably benign
R0295:Knl1	UTSW	2	119088839	missense	probably damaging	1.00
R0433:Knl1	UTSW	2	119104061	missense	probably damaging	0.96
R0453:Knl1	UTSW	2	119068388	missense	probably damaging	1.00
R0569:Knl1	UTSW	2	119097435	missense	possibly damaging	0.95
R0827:Knl1	UTSW	2	119088901	splice site	probably benign
R0920:Knl1	UTSW	2	119069828	missense	probably benign	0.00
R1120:Knl1	UTSW	2	119062375	missense	probably damaging	0.99
R1155:Knl1	UTSW	2	119071154	missense	possibly damaging	0.90
R1204:Knl1	UTSW	2	119071189	missense	probably benign	0.00
R1241:Knl1	UTSW	2	119072573	missense	probably benign	0.03
R1387:Knl1	UTSW	2	119070730	missense	possibly damaging	0.93
R1448:Knl1	UTSW	2	119068307	missense	probably damaging	1.00
R1469:Knl1	UTSW	2	119071346	missense	possibly damaging	0.73
R1469:Knl1	UTSW	2	119071346	missense	possibly damaging	0.73
R1719:Knl1	UTSW	2	119071738	missense	probably benign	0.01
R1721:Knl1	UTSW	2	119076334	missense	probably damaging	1.00
R2128:Knl1	UTSW	2	119071819	missense	possibly damaging	0.79
R2170:Knl1	UTSW	2	119087594	critical splice donor site	probably null
R2227:Knl1	UTSW	2	119072000	missense	probably damaging	0.97
R2246:Knl1	UTSW	2	119072227	missense	probably damaging	1.00
R2275:Knl1	UTSW	2	119072281	missense	probably damaging	0.99
R2508:Knl1	UTSW	2	119058368	nonsense	probably null
R3115:Knl1	UTSW	2	119070391	missense	possibly damaging	0.53
R3122:Knl1	UTSW	2	119068944	missense	probably benign	0.32
R3431:Knl1	UTSW	2	119062362	missense	probably damaging	1.00
R3755:Knl1	UTSW	2	119102579	missense	probably damaging	1.00
R4461:Knl1	UTSW	2	119059599	missense	probably benign	0.00
R4600:Knl1	UTSW	2	119070544	missense	possibly damaging	0.90
R4713:Knl1	UTSW	2	119069137	nonsense	probably null
R4758:Knl1	UTSW	2	119071732	frame shift	probably null
R4762:Knl1	UTSW	2	119071936	missense	probably benign	0.01
R4869:Knl1	UTSW	2	119072351	missense	possibly damaging	0.73
R4870:Knl1	UTSW	2	119081513	missense	probably benign	0.22
R4935:Knl1	UTSW	2	119068957	missense	possibly damaging	0.50
R5167:Knl1	UTSW	2	119070031	missense	probably damaging	1.00
R5184:Knl1	UTSW	2	119069176	missense	probably damaging	1.00
R5293:Knl1	UTSW	2	119069695	missense	probably damaging	0.99
R5326:Knl1	UTSW	2	119068348	missense	possibly damaging	0.66
R5331:Knl1	UTSW	2	119070255	missense	possibly damaging	0.92
R5353:Knl1	UTSW	2	119070983	missense	probably benign	0.01
R5493:Knl1	UTSW	2	119068730	missense	probably damaging	0.98
R5542:Knl1	UTSW	2	119068348	missense	possibly damaging	0.66
R5632:Knl1	UTSW	2	119070352	missense	probably damaging	1.00
R5650:Knl1	UTSW	2	119081550	nonsense	probably null
R5854:Knl1	UTSW	2	119070403	missense	probably benign	0.02
R5979:Knl1	UTSW	2	119069360	missense	possibly damaging	0.83
R6086:Knl1	UTSW	2	119094068	missense	probably damaging	1.00
R6283:Knl1	UTSW	2	119070286	missense	probably damaging	1.00
R6285:Knl1	UTSW	2	119071941	missense	probably damaging	1.00
R6313:Knl1	UTSW	2	119069318	missense	probably damaging	1.00
R6419:Knl1	UTSW	2	119069003	missense	probably benign	0.02
R6608:Knl1	UTSW	2	119086612	missense	probably damaging	0.99
R6881:Knl1	UTSW	2	119095184	missense	possibly damaging	0.67
R7161:Knl1	UTSW	2	119070785	missense	possibly damaging	0.79
R7206:Knl1	UTSW	2	119069299	missense	probably benign	0.35
R7270:Knl1	UTSW	2	119102522	missense	possibly damaging	0.53
R7276:Knl1	UTSW	2	119071686	missense	probably damaging	0.98
R7358:Knl1	UTSW	2	119070559	missense	possibly damaging	0.92
R7402:Knl1	UTSW	2	119095226	nonsense	probably null
R7408:Knl1	UTSW	2	119070592	missense	possibly damaging	0.54
R7475:Knl1	UTSW	2	119087546	missense	probably damaging	1.00
R7516:Knl1	UTSW	2	119070698	missense	probably damaging	0.99
R7524:Knl1	UTSW	2	119065979	missense	probably damaging	1.00
R7559:Knl1	UTSW	2	119094006	missense	possibly damaging	0.84
R7607:Knl1	UTSW	2	119095133	missense	possibly damaging	0.93
R7745:Knl1	UTSW	2	119071556	missense	probably benign	0.13
R8423:Knl1	UTSW	2	119070032	missense	probably damaging	1.00
R8725:Knl1	UTSW	2	119069043	missense	probably benign	0.34
R8727:Knl1	UTSW	2	119069043	missense	probably benign	0.34
R8995:Knl1	UTSW	2	119072509	missense	probably benign	0.11
R9023:Knl1	UTSW	2	119070280	missense	probably benign	0.27
R9100:Knl1	UTSW	2	119068988	missense	probably benign	0.02
R9102:Knl1	UTSW	2	119087492	missense	probably benign	0.22
R9303:Knl1	UTSW	2	119068348	missense	possibly damaging	0.83
R9400:Knl1	UTSW	2	119100743	missense	probably damaging	0.98
R9426:Knl1	UTSW	2	119069498	missense	possibly damaging	0.81
R9583:Knl1	UTSW	2	119057301	missense	probably damaging	1.00
R9616:Knl1	UTSW	2	119069513	missense	probably benign	0.02
R9616:Knl1	UTSW	2	119076944	missense	probably damaging	1.00
R9671:Knl1	UTSW	2	119070608	missense	probably damaging	1.00
R9766:Knl1	UTSW	2	119069900	missense	probably damaging	1.00
R9782:Knl1	UTSW	2	119069429	missense	probably benign	0.02

Predicted Primers

PCR Primer
(F):5'- AGGTCAAACCACTGCTTCAG -3'
(R):5'- CAGACAGCTTTCAGGTTTAGTTTG -3'

Sequencing Primer
(F):5'- CTGCTTCAGAATATAAAACTGTCCC -3'
(R):5'- GTTTCAGCATATTGGCTTCCAC -3'

Posted On

2019-12-20