Incidental Mutation 'R7847:Knl1'
ID606665
Institutional Source Beutler Lab
Gene Symbol Knl1
Ensembl Gene ENSMUSG00000027326
Gene Namekinetochore scaffold 1
Synonyms2310043D08Rik, 5730505K17Rik
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7847 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location119047119-119105501 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 119070976 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Lysine at position 1053 (E1053K)
Ref Sequence ENSEMBL: ENSMUSP00000028799 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028799] [ENSMUST00000028802] [ENSMUST00000099542] [ENSMUST00000152380]
Predicted Effect probably benign
Transcript: ENSMUST00000028799
AA Change: E1053K

PolyPhen 2 Score 0.018 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000028799
Gene: ENSMUSG00000027326
AA Change: E1053K

DomainStartEndE-ValueType
low complexity region 49 58 N/A INTRINSIC
PDB:4A1G|H 126 175 1e-13 PDB
low complexity region 426 433 N/A INTRINSIC
low complexity region 883 894 N/A INTRINSIC
low complexity region 1148 1159 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000028802
AA Change: E1053K

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000028802
Gene: ENSMUSG00000027326
AA Change: E1053K

DomainStartEndE-ValueType
low complexity region 49 58 N/A INTRINSIC
internal_repeat_1 98 304 1.57e-6 PROSPERO
low complexity region 426 433 N/A INTRINSIC
internal_repeat_1 610 824 1.57e-6 PROSPERO
low complexity region 883 894 N/A INTRINSIC
low complexity region 1148 1159 N/A INTRINSIC
low complexity region 1621 1644 N/A INTRINSIC
coiled coil region 1724 1755 N/A INTRINSIC
low complexity region 1836 1850 N/A INTRINSIC
low complexity region 1864 1878 N/A INTRINSIC
PDB:4NF9|B 1899 2119 1e-115 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000099542
AA Change: E1053K

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000097140
Gene: ENSMUSG00000027326
AA Change: E1053K

DomainStartEndE-ValueType
low complexity region 49 58 N/A INTRINSIC
internal_repeat_1 98 304 1.57e-6 PROSPERO
low complexity region 426 433 N/A INTRINSIC
internal_repeat_1 610 824 1.57e-6 PROSPERO
low complexity region 883 894 N/A INTRINSIC
low complexity region 1148 1159 N/A INTRINSIC
low complexity region 1621 1644 N/A INTRINSIC
coiled coil region 1724 1755 N/A INTRINSIC
low complexity region 1836 1850 N/A INTRINSIC
low complexity region 1864 1878 N/A INTRINSIC
PDB:4NF9|B 1899 2119 1e-115 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000152380
SMART Domains Protein: ENSMUSP00000118646
Gene: ENSMUSG00000027326

DomainStartEndE-ValueType
low complexity region 49 58 N/A INTRINSIC
PDB:4A1G|H 126 175 3e-14 PDB
low complexity region 426 433 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (45/45)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a component of the multiprotein assembly that is required for creation of kinetochore-microtubule attachments and chromosome segregation. The encoded protein functions as a scaffold for proteins that influence the spindle assembly checkpoint during the eukaryotic cell cycle and it interacts with at least five different kinetochore proteins and two checkpoint kinases. In adults, this gene is predominantly expressed in normal testes, various cancer cell lines and primary tumors from other tissues and is ubiquitously expressed in fetal tissues. This gene was originally identified as a fusion partner with the mixed-lineage leukemia (MLL) gene in t(11;15)(q23;q14). Mutations in this gene cause autosomal recessive primary microcephaly-4 (MCPH4). Alternative splicing results in multiple transcript variants encoding different isoforms. Additional splice variants have been described but their biological validity has not been confirmed. [provided by RefSeq, Jan 2013]
PHENOTYPE: Mice homozygous for a transgenic gene disruption exhibit embryonic lethality at E6. Mice homozygous for an ENU-induced allele exhibit possible embryonic lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2300002M23Rik T A 17: 35,568,652 Y296N probably benign Het
Abcc4 T C 14: 118,627,480 E378G probably damaging Het
Acp2 C T 2: 91,210,732 H422Y possibly damaging Het
Aldoart1 C T 4: 72,851,956 C205Y probably damaging Het
Alg9 T C 9: 50,789,605 L225S possibly damaging Het
Anapc1 A C 2: 128,669,908 V455G possibly damaging Het
Arhgef5 C A 6: 43,275,135 S940* probably null Het
Asb15 C A 6: 24,564,267 A240E probably damaging Het
BB014433 GCACACAGCTTTGGAGGTGTACACACCCGGGTTGGGGCCTCTACACACAGCTTTGGAGGTGTACACACCCGGGTTGGGGCCTCTGCACACAGCTTTGG GCACACAGCTTTGGAGGTGTACACACCCGGGTTGGGGCCTCTGCACACAGCTTTGG 8: 15,042,160 probably benign Het
Ccdc17 A G 4: 116,599,906 E529G probably benign Het
Cyp2b10 T C 7: 25,897,760 S26P possibly damaging Het
Dcp1b T C 6: 119,215,295 S391P probably benign Het
Dock6 A T 9: 21,801,207 L2086Q unknown Het
Ephx1 A G 1: 181,001,861 S41P probably benign Het
Erbb3 G A 10: 128,571,189 T1034M probably damaging Het
Gm17334 T A 11: 53,772,738 probably benign Het
Golgb1 A G 16: 36,931,920 H3227R probably damaging Het
Grin2c G A 11: 115,260,978 P52L possibly damaging Het
Herc2 T C 7: 56,157,560 probably null Het
Il17rb A G 14: 29,996,806 Y440H probably damaging Het
Kcng4 A G 8: 119,626,142 L343P probably damaging Het
Lipo4 A T 19: 33,514,199 V128E possibly damaging Het
Lmntd2 T C 7: 141,210,150 N650D probably benign Het
Lrrfip2 T C 9: 111,213,880 L460P probably damaging Het
Man2a2 G C 7: 80,368,865 A82G probably benign Het
Mtcl1 T C 17: 66,344,333 Q1379R probably damaging Het
Mtfr2 G A 10: 20,357,452 A256T probably benign Het
Mup17 T A 4: 61,593,219 H159L probably benign Het
Ndufaf1 A T 2: 119,660,053 D175E probably damaging Het
Nup210l A G 3: 90,151,123 M610V probably benign Het
Olfr1338 G T 4: 118,754,368 H59N possibly damaging Het
Olfr1354 T A 10: 78,916,896 S19T probably benign Het
Olfr955 A G 9: 39,470,505 S74P probably benign Het
Pard3b A G 1: 62,343,934 D729G probably benign Het
Phactr1 T C 13: 43,057,188 L169P possibly damaging Het
Rad54b T A 4: 11,612,655 S762R probably damaging Het
Senp5 C T 16: 31,990,173 V88I probably benign Het
Specc1l T C 10: 75,309,836 V1105A probably damaging Het
Trak2 A C 1: 58,935,818 S72A possibly damaging Het
Ttyh2 T C 11: 114,675,674 probably null Het
Ush2a G A 1: 188,430,808 C1029Y probably damaging Het
Vmn2r17 A G 5: 109,420,197 Y62C probably damaging Het
Vmn2r41 A G 7: 8,161,548 F2L probably benign Het
Xirp1 G T 9: 120,019,753 D21E possibly damaging Het
Zfp114 C A 7: 24,181,035 Q270K possibly damaging Het
Zfp341 T C 2: 154,634,194 S441P probably damaging Het
Zfp780b A C 7: 27,964,418 H237Q probably benign Het
Other mutations in Knl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00272:Knl1 APN 2 119064083 missense probably damaging 0.96
IGL00582:Knl1 APN 2 119102499 missense probably benign 0.19
IGL00666:Knl1 APN 2 119070464 missense probably damaging 0.96
IGL01062:Knl1 APN 2 119076980 missense probably benign 0.33
IGL01395:Knl1 APN 2 119071566 missense probably damaging 0.96
IGL01604:Knl1 APN 2 119070001 missense probably damaging 1.00
IGL01996:Knl1 APN 2 119104061 missense probably damaging 1.00
IGL02086:Knl1 APN 2 119100774 missense probably benign 0.40
IGL02105:Knl1 APN 2 119071808 missense probably benign
IGL02106:Knl1 APN 2 119072008 missense possibly damaging 0.89
IGL02201:Knl1 APN 2 119069152 missense probably benign 0.01
IGL02252:Knl1 APN 2 119072540 missense probably damaging 1.00
IGL02414:Knl1 APN 2 119070323 missense possibly damaging 0.83
IGL02655:Knl1 APN 2 119070992 missense possibly damaging 0.62
IGL02682:Knl1 APN 2 119077969 missense possibly damaging 0.86
IGL02710:Knl1 APN 2 119070930 missense probably damaging 0.99
IGL02877:Knl1 APN 2 119088831 missense probably benign 0.08
IGL03100:Knl1 APN 2 119100770 missense probably damaging 0.99
IGL03210:Knl1 APN 2 119070617 missense probably benign 0.02
IGL03138:Knl1 UTSW 2 119072359 missense probably damaging 0.96
R0023:Knl1 UTSW 2 119102549 missense possibly damaging 0.73
R0064:Knl1 UTSW 2 119076243 missense probably benign 0.00
R0064:Knl1 UTSW 2 119076243 missense probably benign 0.00
R0078:Knl1 UTSW 2 119069892 missense probably benign 0.16
R0178:Knl1 UTSW 2 119058405 splice site probably benign
R0295:Knl1 UTSW 2 119088839 missense probably damaging 1.00
R0433:Knl1 UTSW 2 119104061 missense probably damaging 0.96
R0453:Knl1 UTSW 2 119068388 missense probably damaging 1.00
R0569:Knl1 UTSW 2 119097435 missense possibly damaging 0.95
R0827:Knl1 UTSW 2 119088901 splice site probably benign
R0920:Knl1 UTSW 2 119069828 missense probably benign 0.00
R1120:Knl1 UTSW 2 119062375 missense probably damaging 0.99
R1155:Knl1 UTSW 2 119071154 missense possibly damaging 0.90
R1204:Knl1 UTSW 2 119071189 missense probably benign 0.00
R1241:Knl1 UTSW 2 119072573 missense probably benign 0.03
R1387:Knl1 UTSW 2 119070730 missense possibly damaging 0.93
R1448:Knl1 UTSW 2 119068307 missense probably damaging 1.00
R1469:Knl1 UTSW 2 119071346 missense possibly damaging 0.73
R1469:Knl1 UTSW 2 119071346 missense possibly damaging 0.73
R1719:Knl1 UTSW 2 119071738 missense probably benign 0.01
R1721:Knl1 UTSW 2 119076334 missense probably damaging 1.00
R2128:Knl1 UTSW 2 119071819 missense possibly damaging 0.79
R2170:Knl1 UTSW 2 119087594 critical splice donor site probably null
R2227:Knl1 UTSW 2 119072000 missense probably damaging 0.97
R2246:Knl1 UTSW 2 119072227 missense probably damaging 1.00
R2275:Knl1 UTSW 2 119072281 missense probably damaging 0.99
R2508:Knl1 UTSW 2 119058368 nonsense probably null
R3115:Knl1 UTSW 2 119070391 missense possibly damaging 0.53
R3122:Knl1 UTSW 2 119068944 missense probably benign 0.32
R3431:Knl1 UTSW 2 119062362 missense probably damaging 1.00
R3755:Knl1 UTSW 2 119102579 missense probably damaging 1.00
R4461:Knl1 UTSW 2 119059599 missense probably benign 0.00
R4600:Knl1 UTSW 2 119070544 missense possibly damaging 0.90
R4713:Knl1 UTSW 2 119069137 nonsense probably null
R4758:Knl1 UTSW 2 119071732 frame shift probably null
R4762:Knl1 UTSW 2 119071936 missense probably benign 0.01
R4869:Knl1 UTSW 2 119072351 missense possibly damaging 0.73
R4870:Knl1 UTSW 2 119081513 missense probably benign 0.22
R4935:Knl1 UTSW 2 119068957 missense possibly damaging 0.50
R5167:Knl1 UTSW 2 119070031 missense probably damaging 1.00
R5184:Knl1 UTSW 2 119069176 missense probably damaging 1.00
R5293:Knl1 UTSW 2 119069695 missense probably damaging 0.99
R5326:Knl1 UTSW 2 119068348 missense possibly damaging 0.66
R5331:Knl1 UTSW 2 119070255 missense possibly damaging 0.92
R5353:Knl1 UTSW 2 119070983 missense probably benign 0.01
R5493:Knl1 UTSW 2 119068730 missense probably damaging 0.98
R5542:Knl1 UTSW 2 119068348 missense possibly damaging 0.66
R5632:Knl1 UTSW 2 119070352 missense probably damaging 1.00
R5650:Knl1 UTSW 2 119081550 nonsense probably null
R5854:Knl1 UTSW 2 119070403 missense probably benign 0.02
R5979:Knl1 UTSW 2 119069360 missense possibly damaging 0.83
R6086:Knl1 UTSW 2 119094068 missense probably damaging 1.00
R6283:Knl1 UTSW 2 119070286 missense probably damaging 1.00
R6285:Knl1 UTSW 2 119071941 missense probably damaging 1.00
R6313:Knl1 UTSW 2 119069318 missense probably damaging 1.00
R6419:Knl1 UTSW 2 119069003 missense probably benign 0.02
R6608:Knl1 UTSW 2 119086612 missense probably damaging 0.99
R6881:Knl1 UTSW 2 119095184 missense possibly damaging 0.67
R7161:Knl1 UTSW 2 119070785 missense possibly damaging 0.79
R7206:Knl1 UTSW 2 119069299 missense probably benign 0.35
R7270:Knl1 UTSW 2 119102522 missense possibly damaging 0.53
R7276:Knl1 UTSW 2 119071686 missense probably damaging 0.98
R7358:Knl1 UTSW 2 119070559 missense possibly damaging 0.92
R7402:Knl1 UTSW 2 119095226 nonsense probably null
R7408:Knl1 UTSW 2 119070592 missense possibly damaging 0.54
R7475:Knl1 UTSW 2 119087546 missense probably damaging 1.00
R7516:Knl1 UTSW 2 119070698 missense probably damaging 0.99
R7524:Knl1 UTSW 2 119065979 missense probably damaging 1.00
R7559:Knl1 UTSW 2 119094006 missense possibly damaging 0.84
R7607:Knl1 UTSW 2 119095133 missense possibly damaging 0.93
R7745:Knl1 UTSW 2 119071556 missense probably benign 0.13
Predicted Primers PCR Primer
(F):5'- AGGTCAAACCACTGCTTCAG -3'
(R):5'- CAGACAGCTTTCAGGTTTAGTTTG -3'

Sequencing Primer
(F):5'- CTGCTTCAGAATATAAAACTGTCCC -3'
(R):5'- GTTTCAGCATATTGGCTTCCAC -3'
Posted On2019-12-20