Incidental Mutation 'R7847:Ccdc17'
ID606673
Institutional Source Beutler Lab
Gene Symbol Ccdc17
Ensembl Gene ENSMUSG00000034035
Gene Namecoiled-coil domain containing 17
Synonyms1100001F07Rik
Accession Numbers

Genbank: NM_001037916

Is this an essential gene? Probably non essential (E-score: 0.073) question?
Stock #R7847 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location116596654-116600266 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 116599906 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 529 (E529G)
Ref Sequence ENSEMBL: ENSMUSP00000059848 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030456] [ENSMUST00000030457] [ENSMUST00000051869] [ENSMUST00000081182]
Predicted Effect probably benign
Transcript: ENSMUST00000030456
SMART Domains Protein: ENSMUSP00000030456
Gene: ENSMUSG00000028693

DomainStartEndE-ValueType
low complexity region 2 18 N/A INTRINSIC
TPR 43 76 8.51e0 SMART
low complexity region 111 126 N/A INTRINSIC
low complexity region 152 162 N/A INTRINSIC
low complexity region 336 352 N/A INTRINSIC
low complexity region 455 478 N/A INTRINSIC
low complexity region 492 503 N/A INTRINSIC
TPR 528 561 3.05e0 SMART
TPR 570 603 2.38e-2 SMART
low complexity region 620 640 N/A INTRINSIC
low complexity region 703 715 N/A INTRINSIC
low complexity region 742 759 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000030457
SMART Domains Protein: ENSMUSP00000030457
Gene: ENSMUSG00000028693

DomainStartEndE-ValueType
low complexity region 2 18 N/A INTRINSIC
TPR 43 76 8.51e0 SMART
low complexity region 111 126 N/A INTRINSIC
low complexity region 133 153 N/A INTRINSIC
low complexity region 167 178 N/A INTRINSIC
TPR 203 236 3.05e0 SMART
TPR 245 278 2.38e-2 SMART
low complexity region 295 315 N/A INTRINSIC
low complexity region 378 390 N/A INTRINSIC
low complexity region 417 434 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000051869
AA Change: E529G

PolyPhen 2 Score 0.344 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000059848
Gene: ENSMUSG00000034035
AA Change: E529G

DomainStartEndE-ValueType
coiled coil region 97 161 N/A INTRINSIC
coiled coil region 219 270 N/A INTRINSIC
low complexity region 415 427 N/A INTRINSIC
low complexity region 523 537 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000081182
SMART Domains Protein: ENSMUSP00000079946
Gene: ENSMUSG00000028693

DomainStartEndE-ValueType
low complexity region 2 18 N/A INTRINSIC
TPR 43 76 6.2e-2 SMART
low complexity region 84 99 N/A INTRINSIC
low complexity region 106 126 N/A INTRINSIC
low complexity region 140 151 N/A INTRINSIC
TPR 176 209 1.4e-2 SMART
TPR 218 251 1.1e-4 SMART
low complexity region 268 288 N/A INTRINSIC
low complexity region 351 363 N/A INTRINSIC
low complexity region 390 407 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (45/45)
Allele List at MGI

All alleles(2) : Targeted, knock-out(1) Gene trapped(1)

Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2300002M23Rik T A 17: 35,568,652 Y296N probably benign Het
Abcc4 T C 14: 118,627,480 E378G probably damaging Het
Acp2 C T 2: 91,210,732 H422Y possibly damaging Het
Aldoart1 C T 4: 72,851,956 C205Y probably damaging Het
Alg9 T C 9: 50,789,605 L225S possibly damaging Het
Anapc1 A C 2: 128,669,908 V455G possibly damaging Het
Arhgef5 C A 6: 43,275,135 S940* probably null Het
Asb15 C A 6: 24,564,267 A240E probably damaging Het
BB014433 GCACACAGCTTTGGAGGTGTACACACCCGGGTTGGGGCCTCTACACACAGCTTTGGAGGTGTACACACCCGGGTTGGGGCCTCTGCACACAGCTTTGG GCACACAGCTTTGGAGGTGTACACACCCGGGTTGGGGCCTCTGCACACAGCTTTGG 8: 15,042,160 probably benign Het
Cyp2b10 T C 7: 25,897,760 S26P possibly damaging Het
Dcp1b T C 6: 119,215,295 S391P probably benign Het
Dock6 A T 9: 21,801,207 L2086Q unknown Het
Ephx1 A G 1: 181,001,861 S41P probably benign Het
Erbb3 G A 10: 128,571,189 T1034M probably damaging Het
Gm17334 T A 11: 53,772,738 probably benign Het
Golgb1 A G 16: 36,931,920 H3227R probably damaging Het
Grin2c G A 11: 115,260,978 P52L possibly damaging Het
Herc2 T C 7: 56,157,560 probably null Het
Il17rb A G 14: 29,996,806 Y440H probably damaging Het
Kcng4 A G 8: 119,626,142 L343P probably damaging Het
Knl1 G A 2: 119,070,976 E1053K probably benign Het
Lipo4 A T 19: 33,514,199 V128E possibly damaging Het
Lmntd2 T C 7: 141,210,150 N650D probably benign Het
Lrrfip2 T C 9: 111,213,880 L460P probably damaging Het
Man2a2 G C 7: 80,368,865 A82G probably benign Het
Mtcl1 T C 17: 66,344,333 Q1379R probably damaging Het
Mtfr2 G A 10: 20,357,452 A256T probably benign Het
Mup17 T A 4: 61,593,219 H159L probably benign Het
Ndufaf1 A T 2: 119,660,053 D175E probably damaging Het
Nup210l A G 3: 90,151,123 M610V probably benign Het
Olfr1338 G T 4: 118,754,368 H59N possibly damaging Het
Olfr1354 T A 10: 78,916,896 S19T probably benign Het
Olfr955 A G 9: 39,470,505 S74P probably benign Het
Pard3b A G 1: 62,343,934 D729G probably benign Het
Phactr1 T C 13: 43,057,188 L169P possibly damaging Het
Rad54b T A 4: 11,612,655 S762R probably damaging Het
Senp5 C T 16: 31,990,173 V88I probably benign Het
Specc1l T C 10: 75,309,836 V1105A probably damaging Het
Trak2 A C 1: 58,935,818 S72A possibly damaging Het
Ttyh2 T C 11: 114,675,674 probably null Het
Ush2a G A 1: 188,430,808 C1029Y probably damaging Het
Vmn2r17 A G 5: 109,420,197 Y62C probably damaging Het
Vmn2r41 A G 7: 8,161,548 F2L probably benign Het
Xirp1 G T 9: 120,019,753 D21E possibly damaging Het
Zfp114 C A 7: 24,181,035 Q270K possibly damaging Het
Zfp341 T C 2: 154,634,194 S441P probably damaging Het
Zfp780b A C 7: 27,964,418 H237Q probably benign Het
Other mutations in Ccdc17
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01661:Ccdc17 APN 4 116597866 missense probably benign
IGL03106:Ccdc17 APN 4 116596836 unclassified probably null
IGL03169:Ccdc17 APN 4 116597760 missense probably damaging 1.00
IGL03288:Ccdc17 APN 4 116599429 missense probably damaging 1.00
dandy UTSW 4 116599592 missense probably damaging 1.00
Dondi UTSW 4 116598548 missense probably damaging 1.00
G5030:Ccdc17 UTSW 4 116598502 missense probably benign 0.42
R0628:Ccdc17 UTSW 4 116598548 missense probably damaging 1.00
R1033:Ccdc17 UTSW 4 116596880 nonsense probably null
R2041:Ccdc17 UTSW 4 116599592 missense probably damaging 1.00
R3107:Ccdc17 UTSW 4 116598267 missense probably benign 0.02
R3122:Ccdc17 UTSW 4 116599552 unclassified probably benign
R4498:Ccdc17 UTSW 4 116597241 unclassified probably benign
R5705:Ccdc17 UTSW 4 116596869 missense probably benign 0.10
R6052:Ccdc17 UTSW 4 116599948 unclassified probably null
R6083:Ccdc17 UTSW 4 116596926 missense possibly damaging 0.89
R6925:Ccdc17 UTSW 4 116598210 missense probably damaging 1.00
R7677:Ccdc17 UTSW 4 116597765 critical splice donor site probably null
R8195:Ccdc17 UTSW 4 116599014 missense possibly damaging 0.75
R8195:Ccdc17 UTSW 4 116599016 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TCCACTTCTGGTCAGCCTGTAG -3'
(R):5'- TGGCCACTGTTACAAGACC -3'

Sequencing Primer
(F):5'- GCTAAGCAGCTTCTATTAGATAGTG -3'
(R):5'- CCCATTTAAAAAGCTGCAGGTCTAG -3'
Posted On2019-12-20