Incidental Mutation 'R7847:Asb15'
ID606676
Institutional Source Beutler Lab
Gene Symbol Asb15
Ensembl Gene ENSMUSG00000029685
Gene Nameankyrin repeat and SOCS box-containing 15
Synonyms4930400E23Rik
Accession Numbers

Genbank: NM_080847; MGI: 1926160

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7847 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location24528144-24573164 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 24564267 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Glutamic Acid at position 240 (A240E)
Ref Sequence ENSEMBL: ENSMUSP00000031696 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031696] [ENSMUST00000117688]
Predicted Effect probably damaging
Transcript: ENSMUST00000031696
AA Change: A240E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000031696
Gene: ENSMUSG00000029685
AA Change: A240E

DomainStartEndE-ValueType
ANK 110 139 1.59e-3 SMART
ANK 143 172 2.97e-3 SMART
ANK 176 205 1.93e-2 SMART
ANK 209 238 2.1e-3 SMART
ANK 242 273 5.01e-1 SMART
ANK 275 304 2.63e2 SMART
ANK 307 336 1.99e-4 SMART
ANK 349 378 5.24e-4 SMART
ANK 379 408 1.27e-2 SMART
ANK 417 444 2.35e3 SMART
SOCS_box 534 576 2.34e-11 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000117688
AA Change: A240E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000112965
Gene: ENSMUSG00000029685
AA Change: A240E

DomainStartEndE-ValueType
ANK 110 139 1.59e-3 SMART
ANK 143 172 2.97e-3 SMART
ANK 176 205 1.93e-2 SMART
ANK 209 238 2.1e-3 SMART
ANK 242 273 5.01e-1 SMART
ANK 275 304 2.63e2 SMART
ANK 307 336 1.99e-4 SMART
ANK 349 378 5.24e-4 SMART
ANK 379 408 1.27e-2 SMART
ANK 417 444 2.35e3 SMART
SOCS_box 534 576 2.34e-11 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (45/45)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the suppressor of cytokine signaling box superfamily. The proteins in this superfamily participate in the ubiquitin-proteasome system for the degradation of proteins in the cell cycle and signal transduction pathways. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2014]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2300002M23Rik T A 17: 35,568,652 Y296N probably benign Het
Abcc4 T C 14: 118,627,480 E378G probably damaging Het
Acp2 C T 2: 91,210,732 H422Y possibly damaging Het
Aldoart1 C T 4: 72,851,956 C205Y probably damaging Het
Alg9 T C 9: 50,789,605 L225S possibly damaging Het
Anapc1 A C 2: 128,669,908 V455G possibly damaging Het
Arhgef5 C A 6: 43,275,135 S940* probably null Het
BB014433 GCACACAGCTTTGGAGGTGTACACACCCGGGTTGGGGCCTCTACACACAGCTTTGGAGGTGTACACACCCGGGTTGGGGCCTCTGCACACAGCTTTGG GCACACAGCTTTGGAGGTGTACACACCCGGGTTGGGGCCTCTGCACACAGCTTTGG 8: 15,042,160 probably benign Het
Ccdc17 A G 4: 116,599,906 E529G probably benign Het
Cyp2b10 T C 7: 25,897,760 S26P possibly damaging Het
Dcp1b T C 6: 119,215,295 S391P probably benign Het
Dock6 A T 9: 21,801,207 L2086Q unknown Het
Ephx1 A G 1: 181,001,861 S41P probably benign Het
Erbb3 G A 10: 128,571,189 T1034M probably damaging Het
Gm17334 T A 11: 53,772,738 probably benign Het
Golgb1 A G 16: 36,931,920 H3227R probably damaging Het
Grin2c G A 11: 115,260,978 P52L possibly damaging Het
Herc2 T C 7: 56,157,560 probably null Het
Il17rb A G 14: 29,996,806 Y440H probably damaging Het
Kcng4 A G 8: 119,626,142 L343P probably damaging Het
Knl1 G A 2: 119,070,976 E1053K probably benign Het
Lipo4 A T 19: 33,514,199 V128E possibly damaging Het
Lmntd2 T C 7: 141,210,150 N650D probably benign Het
Lrrfip2 T C 9: 111,213,880 L460P probably damaging Het
Man2a2 G C 7: 80,368,865 A82G probably benign Het
Mtcl1 T C 17: 66,344,333 Q1379R probably damaging Het
Mtfr2 G A 10: 20,357,452 A256T probably benign Het
Mup17 T A 4: 61,593,219 H159L probably benign Het
Ndufaf1 A T 2: 119,660,053 D175E probably damaging Het
Nup210l A G 3: 90,151,123 M610V probably benign Het
Olfr1338 G T 4: 118,754,368 H59N possibly damaging Het
Olfr1354 T A 10: 78,916,896 S19T probably benign Het
Olfr955 A G 9: 39,470,505 S74P probably benign Het
Pard3b A G 1: 62,343,934 D729G probably benign Het
Phactr1 T C 13: 43,057,188 L169P possibly damaging Het
Rad54b T A 4: 11,612,655 S762R probably damaging Het
Senp5 C T 16: 31,990,173 V88I probably benign Het
Specc1l T C 10: 75,309,836 V1105A probably damaging Het
Trak2 A C 1: 58,935,818 S72A possibly damaging Het
Ttyh2 T C 11: 114,675,674 probably null Het
Ush2a G A 1: 188,430,808 C1029Y probably damaging Het
Vmn2r17 A G 5: 109,420,197 Y62C probably damaging Het
Vmn2r41 A G 7: 8,161,548 F2L probably benign Het
Xirp1 G T 9: 120,019,753 D21E possibly damaging Het
Zfp114 C A 7: 24,181,035 Q270K possibly damaging Het
Zfp341 T C 2: 154,634,194 S441P probably damaging Het
Zfp780b A C 7: 27,964,418 H237Q probably benign Het
Other mutations in Asb15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00418:Asb15 APN 6 24558643 splice site probably benign
IGL00557:Asb15 APN 6 24558650 missense probably benign
IGL00694:Asb15 APN 6 24570664 missense possibly damaging 0.79
IGL01137:Asb15 APN 6 24556522 missense probably benign
IGL01681:Asb15 APN 6 24567138 missense probably damaging 0.98
IGL01691:Asb15 APN 6 24567272 missense probably benign 0.02
IGL01791:Asb15 APN 6 24567212 missense probably damaging 1.00
IGL01989:Asb15 APN 6 24565944 missense probably damaging 1.00
IGL02480:Asb15 APN 6 24570746 missense probably damaging 0.99
IGL02541:Asb15 APN 6 24566266 missense probably damaging 1.00
IGL02707:Asb15 APN 6 24558788 splice site probably benign
IGL03090:Asb15 APN 6 24567186 missense possibly damaging 0.52
IGL03331:Asb15 APN 6 24556524 missense possibly damaging 0.70
3-1:Asb15 UTSW 6 24566221 missense probably benign 0.00
BB002:Asb15 UTSW 6 24562724 missense probably benign 0.00
BB012:Asb15 UTSW 6 24562724 missense probably benign 0.00
R0196:Asb15 UTSW 6 24564393 missense probably damaging 0.99
R0603:Asb15 UTSW 6 24556557 missense probably damaging 1.00
R0650:Asb15 UTSW 6 24566164 missense probably damaging 1.00
R1114:Asb15 UTSW 6 24567177 missense probably damaging 1.00
R1170:Asb15 UTSW 6 24562487 splice site probably benign
R1365:Asb15 UTSW 6 24567270 missense possibly damaging 0.95
R2323:Asb15 UTSW 6 24556601 missense probably benign 0.01
R3147:Asb15 UTSW 6 24566259 missense probably damaging 1.00
R3148:Asb15 UTSW 6 24566259 missense probably damaging 1.00
R4762:Asb15 UTSW 6 24567237 missense possibly damaging 0.81
R4771:Asb15 UTSW 6 24570622 missense probably damaging 0.99
R4915:Asb15 UTSW 6 24566293 missense probably damaging 0.96
R5369:Asb15 UTSW 6 24562564 missense probably benign 0.00
R5415:Asb15 UTSW 6 24570691 missense probably benign 0.05
R5781:Asb15 UTSW 6 24564378 missense probably benign 0.11
R6649:Asb15 UTSW 6 24562633 missense probably benign
R6653:Asb15 UTSW 6 24562633 missense probably benign
R6781:Asb15 UTSW 6 24558675 missense probably benign
R6984:Asb15 UTSW 6 24566337 missense probably benign 0.17
R7297:Asb15 UTSW 6 24566463 missense probably damaging 0.96
R7340:Asb15 UTSW 6 24558514 missense probably benign 0.00
R7419:Asb15 UTSW 6 24556556 missense probably benign 0.08
R7549:Asb15 UTSW 6 24559030 intron probably null
R7662:Asb15 UTSW 6 24566090 missense probably benign 0.08
R7717:Asb15 UTSW 6 24559252 missense probably benign
R7767:Asb15 UTSW 6 24559282 missense probably benign
R7781:Asb15 UTSW 6 24562645 missense probably benign 0.01
R7797:Asb15 UTSW 6 24562506 missense probably damaging 0.98
R7925:Asb15 UTSW 6 24562724 missense probably benign 0.00
R8055:Asb15 UTSW 6 24556566 missense probably benign 0.05
R8304:Asb15 UTSW 6 24559297 missense possibly damaging 0.89
Z1176:Asb15 UTSW 6 24566331 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTTGTGACTTGCTCTCCTTGAAAG -3'
(R):5'- AGATTGTACTGTACACACGCCTTAG -3'

Sequencing Primer
(F):5'- GACTTGCTCTCCTTGAAAGTTTAATG -3'
(R):5'- TCTGTTGGGCACATTGC -3'
Posted On2019-12-20