Incidental Mutation 'R7847:Vmn2r41'
ID 606679
Institutional Source Beutler Lab
Gene Symbol Vmn2r41
Ensembl Gene ENSMUSG00000090892
Gene Name vomeronasal 2, receptor 41
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Not available question?
Stock # R7847 (G1)
Quality Score 214.009
Status Not validated
Chromosome 7
Chromosomal Location 8136950-8161654 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 8161548 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Leucine at position 2 (F2L)
Ref Sequence ENSEMBL: ENSMUSP00000128337 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000168807]
AlphaFold E9Q5C7
Predicted Effect probably benign
Transcript: ENSMUST00000168807
AA Change: F2L

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000128337
Gene: ENSMUSG00000090892
AA Change: F2L

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
low complexity region 59 71 N/A INTRINSIC
Pfam:ANF_receptor 73 468 2.6e-32 PFAM
Pfam:NCD3G 512 565 1.5e-19 PFAM
Pfam:7tm_3 595 834 1.5e-78 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (45/45)
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2300002M23Rik T A 17: 35,568,652 Y296N probably benign Het
Abcc4 T C 14: 118,627,480 E378G probably damaging Het
Acp2 C T 2: 91,210,732 H422Y possibly damaging Het
Aldoart1 C T 4: 72,851,956 C205Y probably damaging Het
Alg9 T C 9: 50,789,605 L225S possibly damaging Het
Anapc1 A C 2: 128,669,908 V455G possibly damaging Het
Arhgef5 C A 6: 43,275,135 S940* probably null Het
Asb15 C A 6: 24,564,267 A240E probably damaging Het
BB014433 GCACACAGCTTTGGAGGTGTACACACCCGGGTTGGGGCCTCTACACACAGCTTTGGAGGTGTACACACCCGGGTTGGGGCCTCTGCACACAGCTTTGG GCACACAGCTTTGGAGGTGTACACACCCGGGTTGGGGCCTCTGCACACAGCTTTGG 8: 15,042,160 probably benign Het
Ccdc17 A G 4: 116,599,906 E529G probably benign Het
Cyp2b10 T C 7: 25,897,760 S26P possibly damaging Het
Dcp1b T C 6: 119,215,295 S391P probably benign Het
Dock6 A T 9: 21,801,207 L2086Q unknown Het
Ephx1 A G 1: 181,001,861 S41P probably benign Het
Erbb3 G A 10: 128,571,189 T1034M probably damaging Het
Gm17334 T A 11: 53,772,738 probably benign Het
Golgb1 A G 16: 36,931,920 H3227R probably damaging Het
Grin2c G A 11: 115,260,978 P52L possibly damaging Het
Herc2 T C 7: 56,157,560 probably null Het
Il17rb A G 14: 29,996,806 Y440H probably damaging Het
Kcng4 A G 8: 119,626,142 L343P probably damaging Het
Knl1 G A 2: 119,070,976 E1053K probably benign Het
Lipo4 A T 19: 33,514,199 V128E possibly damaging Het
Lmntd2 T C 7: 141,210,150 N650D probably benign Het
Lrrfip2 T C 9: 111,213,880 L460P probably damaging Het
Man2a2 G C 7: 80,368,865 A82G probably benign Het
Mtcl1 T C 17: 66,344,333 Q1379R probably damaging Het
Mtfr2 G A 10: 20,357,452 A256T probably benign Het
Mup17 T A 4: 61,593,219 H159L probably benign Het
Ndufaf1 A T 2: 119,660,053 D175E probably damaging Het
Nup210l A G 3: 90,151,123 M610V probably benign Het
Olfr1338 G T 4: 118,754,368 H59N possibly damaging Het
Olfr1354 T A 10: 78,916,896 S19T probably benign Het
Olfr955 A G 9: 39,470,505 S74P probably benign Het
Pard3b A G 1: 62,343,934 D729G probably benign Het
Phactr1 T C 13: 43,057,188 L169P possibly damaging Het
Rad54b T A 4: 11,612,655 S762R probably damaging Het
Senp5 C T 16: 31,990,173 V88I probably benign Het
Specc1l T C 10: 75,309,836 V1105A probably damaging Het
Trak2 A C 1: 58,935,818 S72A possibly damaging Het
Ttyh2 T C 11: 114,675,674 probably null Het
Ush2a G A 1: 188,430,808 C1029Y probably damaging Het
Vmn2r17 A G 5: 109,420,197 Y62C probably damaging Het
Xirp1 G T 9: 120,019,753 D21E possibly damaging Het
Zfp114 C A 7: 24,181,035 Q270K possibly damaging Het
Zfp341 T C 2: 154,634,194 S441P probably damaging Het
Zfp780b A C 7: 27,964,418 H237Q probably benign Het
Other mutations in Vmn2r41
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02345:Vmn2r41 APN 7 8138768 missense probably damaging 0.99
IGL03342:Vmn2r41 APN 7 8138683 missense probably damaging 0.99
R5103:Vmn2r41 UTSW 7 8138342 missense probably benign 0.00
R5440:Vmn2r41 UTSW 7 8138363 missense probably damaging 1.00
R6232:Vmn2r41 UTSW 7 8150215 critical splice donor site probably null
R6603:Vmn2r41 UTSW 7 8138360 missense probably damaging 1.00
R8798:Vmn2r41 UTSW 7 8161523 missense probably damaging 1.00
R9075:Vmn2r41 UTSW 7 8138251 missense probably benign 0.19
R9567:Vmn2r41 UTSW 7 8138392 missense probably benign 0.05
R9574:Vmn2r41 UTSW 7 8150330 missense probably benign 0.06
R9586:Vmn2r41 UTSW 7 8138743 missense
Predicted Primers PCR Primer
(F):5'- TTCATCCTCAGAGCACTCAAG -3'
(R):5'- TGTGGACACCAGTTGCAGAG -3'

Sequencing Primer
(F):5'- TCCTCAGAGCACTCAAGAAATATTG -3'
(R):5'- TTGCAGAGCCCCAGGGAAG -3'
Posted On 2019-12-20