Incidental Mutation 'R7847:Zfp114'
ID 606680
Institutional Source Beutler Lab
Gene Symbol Zfp114
Ensembl Gene ENSMUSG00000068962
Gene Name zinc finger protein 114
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.053) question?
Stock # R7847 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 24175060-24183188 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to A at 24181035 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamine to Lysine at position 270 (Q270K)
Ref Sequence ENSEMBL: ENSMUSP00000083173 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086010] [ENSMUST00000205309] [ENSMUST00000206547]
AlphaFold B2RRA8
Predicted Effect possibly damaging
Transcript: ENSMUST00000086010
AA Change: Q270K

PolyPhen 2 Score 0.669 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000083173
Gene: ENSMUSG00000068962
AA Change: Q270K

DomainStartEndE-ValueType
KRAB 8 68 1.38e-17 SMART
low complexity region 158 168 N/A INTRINSIC
ZnF_C2H2 306 328 6.57e-1 SMART
ZnF_C2H2 334 356 1.95e-3 SMART
ZnF_C2H2 362 384 2.36e-2 SMART
ZnF_C2H2 390 412 3.16e-3 SMART
ZnF_C2H2 418 440 2.84e-5 SMART
ZnF_C2H2 446 468 4.87e-4 SMART
ZnF_C2H2 474 496 2.24e-3 SMART
ZnF_C2H2 502 524 7.37e-4 SMART
ZnF_C2H2 530 552 1.6e-4 SMART
ZnF_C2H2 558 580 2.36e-2 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000205309
AA Change: Q269K

PolyPhen 2 Score 0.795 (Sensitivity: 0.85; Specificity: 0.93)
Predicted Effect possibly damaging
Transcript: ENSMUST00000206547
AA Change: Q269K

PolyPhen 2 Score 0.795 (Sensitivity: 0.85; Specificity: 0.93)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (45/45)
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2300002M23Rik T A 17: 35,568,652 Y296N probably benign Het
Abcc4 T C 14: 118,627,480 E378G probably damaging Het
Acp2 C T 2: 91,210,732 H422Y possibly damaging Het
Aldoart1 C T 4: 72,851,956 C205Y probably damaging Het
Alg9 T C 9: 50,789,605 L225S possibly damaging Het
Anapc1 A C 2: 128,669,908 V455G possibly damaging Het
Arhgef5 C A 6: 43,275,135 S940* probably null Het
Asb15 C A 6: 24,564,267 A240E probably damaging Het
BB014433 GCACACAGCTTTGGAGGTGTACACACCCGGGTTGGGGCCTCTACACACAGCTTTGGAGGTGTACACACCCGGGTTGGGGCCTCTGCACACAGCTTTGG GCACACAGCTTTGGAGGTGTACACACCCGGGTTGGGGCCTCTGCACACAGCTTTGG 8: 15,042,160 probably benign Het
Ccdc17 A G 4: 116,599,906 E529G probably benign Het
Cyp2b10 T C 7: 25,897,760 S26P possibly damaging Het
Dcp1b T C 6: 119,215,295 S391P probably benign Het
Dock6 A T 9: 21,801,207 L2086Q unknown Het
Ephx1 A G 1: 181,001,861 S41P probably benign Het
Erbb3 G A 10: 128,571,189 T1034M probably damaging Het
Gm17334 T A 11: 53,772,738 probably benign Het
Golgb1 A G 16: 36,931,920 H3227R probably damaging Het
Grin2c G A 11: 115,260,978 P52L possibly damaging Het
Herc2 T C 7: 56,157,560 probably null Het
Il17rb A G 14: 29,996,806 Y440H probably damaging Het
Kcng4 A G 8: 119,626,142 L343P probably damaging Het
Knl1 G A 2: 119,070,976 E1053K probably benign Het
Lipo4 A T 19: 33,514,199 V128E possibly damaging Het
Lmntd2 T C 7: 141,210,150 N650D probably benign Het
Lrrfip2 T C 9: 111,213,880 L460P probably damaging Het
Man2a2 G C 7: 80,368,865 A82G probably benign Het
Mtcl1 T C 17: 66,344,333 Q1379R probably damaging Het
Mtfr2 G A 10: 20,357,452 A256T probably benign Het
Mup17 T A 4: 61,593,219 H159L probably benign Het
Ndufaf1 A T 2: 119,660,053 D175E probably damaging Het
Nup210l A G 3: 90,151,123 M610V probably benign Het
Olfr1338 G T 4: 118,754,368 H59N possibly damaging Het
Olfr1354 T A 10: 78,916,896 S19T probably benign Het
Olfr955 A G 9: 39,470,505 S74P probably benign Het
Pard3b A G 1: 62,343,934 D729G probably benign Het
Phactr1 T C 13: 43,057,188 L169P possibly damaging Het
Rad54b T A 4: 11,612,655 S762R probably damaging Het
Senp5 C T 16: 31,990,173 V88I probably benign Het
Specc1l T C 10: 75,309,836 V1105A probably damaging Het
Trak2 A C 1: 58,935,818 S72A possibly damaging Het
Ttyh2 T C 11: 114,675,674 probably null Het
Ush2a G A 1: 188,430,808 C1029Y probably damaging Het
Vmn2r17 A G 5: 109,420,197 Y62C probably damaging Het
Vmn2r41 A G 7: 8,161,548 F2L probably benign Het
Xirp1 G T 9: 120,019,753 D21E possibly damaging Het
Zfp341 T C 2: 154,634,194 S441P probably damaging Het
Zfp780b A C 7: 27,964,418 H237Q probably benign Het
Other mutations in Zfp114
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03241:Zfp114 APN 7 24181012 missense probably benign 0.14
R0139:Zfp114 UTSW 7 24181260 missense possibly damaging 0.69
R1443:Zfp114 UTSW 7 24177769 missense probably damaging 1.00
R1793:Zfp114 UTSW 7 24177739 splice site probably null
R2169:Zfp114 UTSW 7 24181084 missense probably benign 0.04
R3928:Zfp114 UTSW 7 24181042 missense possibly damaging 0.93
R4915:Zfp114 UTSW 7 24177865 missense probably damaging 1.00
R6468:Zfp114 UTSW 7 24177781 missense possibly damaging 0.94
R7102:Zfp114 UTSW 7 24180658 missense possibly damaging 0.84
R7480:Zfp114 UTSW 7 24181882 missense probably damaging 1.00
R8677:Zfp114 UTSW 7 24180645 missense probably benign 0.15
R9496:Zfp114 UTSW 7 24181038 missense possibly damaging 0.89
R9619:Zfp114 UTSW 7 24180652 missense probably benign 0.00
X0026:Zfp114 UTSW 7 24180405 missense possibly damaging 0.92
X0061:Zfp114 UTSW 7 24180460 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- GAGTTGCATTTCCCACCATAACAAC -3'
(R):5'- CGGCAGTGGATGTTGAGATC -3'

Sequencing Primer
(F):5'- GACTGTGGCAAAGTCATTTTTCCAG -3'
(R):5'- ATCTGAGGTGCGGCTGAAGC -3'
Posted On 2019-12-20