Incidental Mutation 'R7847:Zfp780b'
ID606682
Institutional Source Beutler Lab
Gene Symbol Zfp780b
Ensembl Gene ENSMUSG00000063047
Gene Namezinc finger protein 780B
SynonymsB230208L21Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.069) question?
Stock #R7847 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location27959135-27979171 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 27964418 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 237 (H237Q)
Ref Sequence ENSEMBL: ENSMUSP00000146224 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081618] [ENSMUST00000205874] [ENSMUST00000206685]
Predicted Effect probably benign
Transcript: ENSMUST00000081618
AA Change: H237Q

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000080324
Gene: ENSMUSG00000063047
AA Change: H237Q

DomainStartEndE-ValueType
KRAB 14 75 8.48e-36 SMART
ZnF_C2H2 171 193 2.91e-2 SMART
ZnF_C2H2 199 221 3.44e-4 SMART
ZnF_C2H2 227 249 3.11e-2 SMART
ZnF_C2H2 255 277 2.4e-3 SMART
ZnF_C2H2 283 305 2.15e-5 SMART
ZnF_C2H2 311 333 1.18e-2 SMART
ZnF_C2H2 339 361 1.47e-3 SMART
ZnF_C2H2 367 389 1.79e-2 SMART
ZnF_C2H2 395 417 2.24e-3 SMART
ZnF_C2H2 423 445 7.9e-4 SMART
ZnF_C2H2 451 473 8.34e-3 SMART
ZnF_C2H2 479 501 7.9e-4 SMART
ZnF_C2H2 507 529 3.16e-3 SMART
ZnF_C2H2 535 557 1.58e-3 SMART
ZnF_C2H2 563 585 9.08e-4 SMART
ZnF_C2H2 591 613 1.36e-2 SMART
ZnF_C2H2 619 641 1.04e-3 SMART
ZnF_C2H2 647 669 1.2e-3 SMART
ZnF_C2H2 675 697 2.24e-3 SMART
ZnF_C2H2 703 725 1.03e-2 SMART
ZnF_C2H2 731 753 4.17e-3 SMART
ZnF_C2H2 759 781 1.78e2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000205874
Predicted Effect probably benign
Transcript: ENSMUST00000206685
AA Change: H237Q

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2300002M23Rik T A 17: 35,568,652 Y296N probably benign Het
Abcc4 T C 14: 118,627,480 E378G probably damaging Het
Acp2 C T 2: 91,210,732 H422Y possibly damaging Het
Aldoart1 C T 4: 72,851,956 C205Y probably damaging Het
Alg9 T C 9: 50,789,605 L225S possibly damaging Het
Anapc1 A C 2: 128,669,908 V455G possibly damaging Het
Arhgef5 C A 6: 43,275,135 S940* probably null Het
Asb15 C A 6: 24,564,267 A240E probably damaging Het
BB014433 GCACACAGCTTTGGAGGTGTACACACCCGGGTTGGGGCCTCTACACACAGCTTTGGAGGTGTACACACCCGGGTTGGGGCCTCTGCACACAGCTTTGG GCACACAGCTTTGGAGGTGTACACACCCGGGTTGGGGCCTCTGCACACAGCTTTGG 8: 15,042,160 probably benign Het
Ccdc17 A G 4: 116,599,906 E529G probably benign Het
Cyp2b10 T C 7: 25,897,760 S26P possibly damaging Het
Dcp1b T C 6: 119,215,295 S391P probably benign Het
Dock6 A T 9: 21,801,207 L2086Q unknown Het
Ephx1 A G 1: 181,001,861 S41P probably benign Het
Erbb3 G A 10: 128,571,189 T1034M probably damaging Het
Gm17334 T A 11: 53,772,738 probably benign Het
Golgb1 A G 16: 36,931,920 H3227R probably damaging Het
Grin2c G A 11: 115,260,978 P52L possibly damaging Het
Herc2 T C 7: 56,157,560 probably null Het
Il17rb A G 14: 29,996,806 Y440H probably damaging Het
Kcng4 A G 8: 119,626,142 L343P probably damaging Het
Knl1 G A 2: 119,070,976 E1053K probably benign Het
Lipo4 A T 19: 33,514,199 V128E possibly damaging Het
Lmntd2 T C 7: 141,210,150 N650D probably benign Het
Man2a2 G C 7: 80,368,865 A82G probably benign Het
Mtcl1 T C 17: 66,344,333 Q1379R probably damaging Het
Mtfr2 G A 10: 20,357,452 A256T probably benign Het
Mup17 T A 4: 61,593,219 H159L probably benign Het
Ndufaf1 A T 2: 119,660,053 D175E probably damaging Het
Nup210l A G 3: 90,151,123 M610V probably benign Het
Olfr1338 G T 4: 118,754,368 H59N possibly damaging Het
Olfr1354 T A 10: 78,916,896 S19T probably benign Het
Olfr955 A G 9: 39,470,505 S74P probably benign Het
Pard3b A G 1: 62,343,934 D729G probably benign Het
Phactr1 T C 13: 43,057,188 L169P possibly damaging Het
Rad54b T A 4: 11,612,655 S762R probably damaging Het
Senp5 C T 16: 31,990,173 V88I probably benign Het
Specc1l T C 10: 75,309,836 V1105A probably damaging Het
Trak2 A C 1: 58,935,818 S72A possibly damaging Het
Ttyh2 T C 11: 114,675,674 probably null Het
Ush2a G A 1: 188,430,808 C1029Y probably damaging Het
Vmn2r17 A G 5: 109,420,197 Y62C probably damaging Het
Vmn2r41 A G 7: 8,161,548 F2L probably benign Het
Xirp1 G T 9: 120,019,753 D21E possibly damaging Het
Zfp114 C A 7: 24,181,035 Q270K possibly damaging Het
Zfp341 T C 2: 154,634,194 S441P probably damaging Het
Other mutations in Zfp780b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00782:Zfp780b APN 7 27964761 missense probably benign
IGL03088:Zfp780b APN 7 27962992 missense possibly damaging 0.84
IGL03211:Zfp780b APN 7 27963175 missense possibly damaging 0.93
R0403:Zfp780b UTSW 7 27971689 missense possibly damaging 0.47
R1458:Zfp780b UTSW 7 27964827 missense probably damaging 0.99
R1550:Zfp780b UTSW 7 27964857 missense probably benign
R1694:Zfp780b UTSW 7 27964383 missense possibly damaging 0.86
R1823:Zfp780b UTSW 7 27963100 missense possibly damaging 0.93
R2113:Zfp780b UTSW 7 27963873 missense possibly damaging 0.85
R3086:Zfp780b UTSW 7 27963630 missense probably damaging 0.96
R4620:Zfp780b UTSW 7 27962753 nonsense probably null
R5023:Zfp780b UTSW 7 27963448 missense possibly damaging 0.88
R5521:Zfp780b UTSW 7 27974748 splice site probably null
R5582:Zfp780b UTSW 7 27964827 missense probably damaging 0.99
R5677:Zfp780b UTSW 7 27962799 missense probably benign 0.33
R5762:Zfp780b UTSW 7 27964818 missense probably benign
R5998:Zfp780b UTSW 7 27964622 missense probably benign 0.07
R6036:Zfp780b UTSW 7 27963568 missense probably damaging 0.99
R6036:Zfp780b UTSW 7 27963568 missense probably damaging 0.99
R6050:Zfp780b UTSW 7 27964302 missense probably damaging 0.98
R6702:Zfp780b UTSW 7 27971641 missense possibly damaging 0.91
R6703:Zfp780b UTSW 7 27971641 missense possibly damaging 0.91
R7112:Zfp780b UTSW 7 27963141 missense probably damaging 0.98
R7311:Zfp780b UTSW 7 27963163 missense possibly damaging 0.92
R7469:Zfp780b UTSW 7 27963957 missense probably benign 0.02
R7561:Zfp780b UTSW 7 27964612 missense possibly damaging 0.92
R7930:Zfp780b UTSW 7 27964418 missense probably benign 0.00
X0024:Zfp780b UTSW 7 27963250 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GTTTGAGCGACGCTTAAAGG -3'
(R):5'- TGCCAGACTCTTGCTCACAATAC -3'

Sequencing Primer
(F):5'- AGCGACGCTTAAAGGCTTTC -3'
(R):5'- CCATATGAATGTAAAGAGTGTGGG -3'
Posted On2019-12-20