Incidental Mutation 'R7847:Kcng4'
ID606687
Institutional Source Beutler Lab
Gene Symbol Kcng4
Ensembl Gene ENSMUSG00000045246
Gene Namepotassium voltage-gated channel, subfamily G, member 4
SynonymsKV6.4, 4921535I01Rik, KV6.3
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7847 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location119623854-119635680 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 119626142 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 343 (L343P)
Ref Sequence ENSEMBL: ENSMUSP00000056552 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061828] [ENSMUST00000164382]
Predicted Effect probably damaging
Transcript: ENSMUST00000061828
AA Change: L343P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000056552
Gene: ENSMUSG00000045246
AA Change: L343P

DomainStartEndE-ValueType
BTB 58 168 7.13e-3 SMART
Pfam:Ion_trans 218 462 1.2e-40 PFAM
Pfam:Ion_trans_2 370 457 7e-14 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000164382
AA Change: L343P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000129687
Gene: ENSMUSG00000045246
AA Change: L343P

DomainStartEndE-ValueType
BTB 58 168 7.13e-3 SMART
Pfam:Ion_trans 262 451 6.6e-29 PFAM
Pfam:Ion_trans_2 371 457 1.7e-13 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (45/45)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Voltage-gated potassium (Kv) channels represent the most complex class of voltage-gated ion channels from both functional and structural standpoints. Their diverse functions include regulating neurotransmitter release, heart rate, insulin secretion, neuronal excitability, epithelial electrolyte transport, smooth muscle contraction, and cell volume. This gene encodes a member of the potassium channel, voltage-gated, subfamily G. This member functions as a modulatory subunit. The gene has strong expression in brain. Multiple alternatively spliced variants have been found in normal and cancerous tissues. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2300002M23Rik T A 17: 35,568,652 Y296N probably benign Het
Abcc4 T C 14: 118,627,480 E378G probably damaging Het
Acp2 C T 2: 91,210,732 H422Y possibly damaging Het
Aldoart1 C T 4: 72,851,956 C205Y probably damaging Het
Alg9 T C 9: 50,789,605 L225S possibly damaging Het
Anapc1 A C 2: 128,669,908 V455G possibly damaging Het
Arhgef5 C A 6: 43,275,135 S940* probably null Het
Asb15 C A 6: 24,564,267 A240E probably damaging Het
BB014433 GCACACAGCTTTGGAGGTGTACACACCCGGGTTGGGGCCTCTACACACAGCTTTGGAGGTGTACACACCCGGGTTGGGGCCTCTGCACACAGCTTTGG GCACACAGCTTTGGAGGTGTACACACCCGGGTTGGGGCCTCTGCACACAGCTTTGG 8: 15,042,160 probably benign Het
Ccdc17 A G 4: 116,599,906 E529G probably benign Het
Cyp2b10 T C 7: 25,897,760 S26P possibly damaging Het
Dcp1b T C 6: 119,215,295 S391P probably benign Het
Dock6 A T 9: 21,801,207 L2086Q unknown Het
Ephx1 A G 1: 181,001,861 S41P probably benign Het
Erbb3 G A 10: 128,571,189 T1034M probably damaging Het
Gm17334 T A 11: 53,772,738 probably benign Het
Golgb1 A G 16: 36,931,920 H3227R probably damaging Het
Grin2c G A 11: 115,260,978 P52L possibly damaging Het
Herc2 T C 7: 56,157,560 probably null Het
Il17rb A G 14: 29,996,806 Y440H probably damaging Het
Knl1 G A 2: 119,070,976 E1053K probably benign Het
Lipo4 A T 19: 33,514,199 V128E possibly damaging Het
Lmntd2 T C 7: 141,210,150 N650D probably benign Het
Lrrfip2 T C 9: 111,213,880 L460P probably damaging Het
Man2a2 G C 7: 80,368,865 A82G probably benign Het
Mtcl1 T C 17: 66,344,333 Q1379R probably damaging Het
Mtfr2 G A 10: 20,357,452 A256T probably benign Het
Mup17 T A 4: 61,593,219 H159L probably benign Het
Ndufaf1 A T 2: 119,660,053 D175E probably damaging Het
Nup210l A G 3: 90,151,123 M610V probably benign Het
Olfr1338 G T 4: 118,754,368 H59N possibly damaging Het
Olfr1354 T A 10: 78,916,896 S19T probably benign Het
Olfr955 A G 9: 39,470,505 S74P probably benign Het
Pard3b A G 1: 62,343,934 D729G probably benign Het
Phactr1 T C 13: 43,057,188 L169P possibly damaging Het
Rad54b T A 4: 11,612,655 S762R probably damaging Het
Senp5 C T 16: 31,990,173 V88I probably benign Het
Specc1l T C 10: 75,309,836 V1105A probably damaging Het
Trak2 A C 1: 58,935,818 S72A possibly damaging Het
Ttyh2 T C 11: 114,675,674 probably null Het
Ush2a G A 1: 188,430,808 C1029Y probably damaging Het
Vmn2r17 A G 5: 109,420,197 Y62C probably damaging Het
Vmn2r41 A G 7: 8,161,548 F2L probably benign Het
Xirp1 G T 9: 120,019,753 D21E possibly damaging Het
Zfp114 C A 7: 24,181,035 Q270K possibly damaging Het
Zfp341 T C 2: 154,634,194 S441P probably damaging Het
Zfp780b A C 7: 27,964,418 H237Q probably benign Het
Other mutations in Kcng4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00569:Kcng4 APN 8 119626331 missense probably benign 0.00
IGL01360:Kcng4 APN 8 119625677 missense probably benign 0.40
IGL02094:Kcng4 APN 8 119633221 missense probably damaging 0.98
IGL02205:Kcng4 APN 8 119626083 missense probably damaging 0.99
IGL02892:Kcng4 APN 8 119633082 missense probably benign
IGL02927:Kcng4 APN 8 119626322 missense probably benign
IGL02954:Kcng4 APN 8 119633053 missense probably benign
IGL03143:Kcng4 APN 8 119625770 missense probably damaging 1.00
FR4449:Kcng4 UTSW 8 119633519 nonsense probably null
FR4548:Kcng4 UTSW 8 119633519 nonsense probably null
FR4737:Kcng4 UTSW 8 119633519 nonsense probably null
FR4976:Kcng4 UTSW 8 119633519 nonsense probably null
LCD18:Kcng4 UTSW 8 119633519 nonsense probably null
R0017:Kcng4 UTSW 8 119633520 missense probably damaging 1.00
R1777:Kcng4 UTSW 8 119633487 missense probably benign 0.02
R1852:Kcng4 UTSW 8 119626208 missense probably benign 0.01
R1967:Kcng4 UTSW 8 119632923 missense probably damaging 1.00
R3886:Kcng4 UTSW 8 119633247 missense probably benign 0.34
R4009:Kcng4 UTSW 8 119626085 missense probably damaging 1.00
R5137:Kcng4 UTSW 8 119625878 missense possibly damaging 0.88
R5792:Kcng4 UTSW 8 119626279 missense probably damaging 1.00
R5987:Kcng4 UTSW 8 119626359 missense probably damaging 1.00
R6339:Kcng4 UTSW 8 119632954 missense probably damaging 1.00
R6379:Kcng4 UTSW 8 119633620 nonsense probably null
R6430:Kcng4 UTSW 8 119633050 missense probably damaging 0.96
X0024:Kcng4 UTSW 8 119633367 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CGGTCGTCATGGAGATGATG -3'
(R):5'- AACAAATGTCAGTTCTTCCGCG -3'

Sequencing Primer
(F):5'- GATGCTAGTGAACTCCAGGACC -3'
(R):5'- GGGCCCCTGAATGTCATC -3'
Posted On2019-12-20