Incidental Mutation 'R7847:Olfr955'
ID606689
Institutional Source Beutler Lab
Gene Symbol Olfr955
Ensembl Gene ENSMUSG00000063176
Gene Nameolfactory receptor 955
SynonymsMOR171-50, GA_x6K02T2PVTD-33167297-33166353, MOR171-34
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.116) question?
Stock #R7847 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location39465801-39471944 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 39470505 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 74 (S74P)
Ref Sequence ENSEMBL: ENSMUSP00000151246 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073946] [ENSMUST00000220176]
Predicted Effect probably benign
Transcript: ENSMUST00000073946
AA Change: S74P

PolyPhen 2 Score 0.417 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000073602
Gene: ENSMUSG00000063176
AA Change: S74P

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 1.2e-46 PFAM
Pfam:7tm_1 41 290 1.2e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000220176
AA Change: S74P

PolyPhen 2 Score 0.417 (Sensitivity: 0.89; Specificity: 0.90)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (45/45)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2300002M23Rik T A 17: 35,568,652 Y296N probably benign Het
Abcc4 T C 14: 118,627,480 E378G probably damaging Het
Acp2 C T 2: 91,210,732 H422Y possibly damaging Het
Aldoart1 C T 4: 72,851,956 C205Y probably damaging Het
Alg9 T C 9: 50,789,605 L225S possibly damaging Het
Anapc1 A C 2: 128,669,908 V455G possibly damaging Het
Arhgef5 C A 6: 43,275,135 S940* probably null Het
Asb15 C A 6: 24,564,267 A240E probably damaging Het
BB014433 GCACACAGCTTTGGAGGTGTACACACCCGGGTTGGGGCCTCTACACACAGCTTTGGAGGTGTACACACCCGGGTTGGGGCCTCTGCACACAGCTTTGG GCACACAGCTTTGGAGGTGTACACACCCGGGTTGGGGCCTCTGCACACAGCTTTGG 8: 15,042,160 probably benign Het
Ccdc17 A G 4: 116,599,906 E529G probably benign Het
Cyp2b10 T C 7: 25,897,760 S26P possibly damaging Het
Dcp1b T C 6: 119,215,295 S391P probably benign Het
Dock6 A T 9: 21,801,207 L2086Q unknown Het
Ephx1 A G 1: 181,001,861 S41P probably benign Het
Erbb3 G A 10: 128,571,189 T1034M probably damaging Het
Gm17334 T A 11: 53,772,738 probably benign Het
Golgb1 A G 16: 36,931,920 H3227R probably damaging Het
Grin2c G A 11: 115,260,978 P52L possibly damaging Het
Herc2 T C 7: 56,157,560 probably null Het
Il17rb A G 14: 29,996,806 Y440H probably damaging Het
Kcng4 A G 8: 119,626,142 L343P probably damaging Het
Knl1 G A 2: 119,070,976 E1053K probably benign Het
Lipo4 A T 19: 33,514,199 V128E possibly damaging Het
Lmntd2 T C 7: 141,210,150 N650D probably benign Het
Lrrfip2 T C 9: 111,213,880 L460P probably damaging Het
Man2a2 G C 7: 80,368,865 A82G probably benign Het
Mtcl1 T C 17: 66,344,333 Q1379R probably damaging Het
Mtfr2 G A 10: 20,357,452 A256T probably benign Het
Mup17 T A 4: 61,593,219 H159L probably benign Het
Ndufaf1 A T 2: 119,660,053 D175E probably damaging Het
Nup210l A G 3: 90,151,123 M610V probably benign Het
Olfr1338 G T 4: 118,754,368 H59N possibly damaging Het
Olfr1354 T A 10: 78,916,896 S19T probably benign Het
Pard3b A G 1: 62,343,934 D729G probably benign Het
Phactr1 T C 13: 43,057,188 L169P possibly damaging Het
Rad54b T A 4: 11,612,655 S762R probably damaging Het
Senp5 C T 16: 31,990,173 V88I probably benign Het
Specc1l T C 10: 75,309,836 V1105A probably damaging Het
Trak2 A C 1: 58,935,818 S72A possibly damaging Het
Ttyh2 T C 11: 114,675,674 probably null Het
Ush2a G A 1: 188,430,808 C1029Y probably damaging Het
Vmn2r17 A G 5: 109,420,197 Y62C probably damaging Het
Vmn2r41 A G 7: 8,161,548 F2L probably benign Het
Xirp1 G T 9: 120,019,753 D21E possibly damaging Het
Zfp114 C A 7: 24,181,035 Q270K possibly damaging Het
Zfp341 T C 2: 154,634,194 S441P probably damaging Het
Zfp780b A C 7: 27,964,418 H237Q probably benign Het
Other mutations in Olfr955
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00157:Olfr955 APN 9 39470243 missense probably benign 0.00
IGL02550:Olfr955 APN 9 39470546 missense probably benign 0.42
IGL02743:Olfr955 APN 9 39470246 missense probably benign 0.10
R0029:Olfr955 UTSW 9 39470660 missense probably benign 0.06
R0329:Olfr955 UTSW 9 39470556 missense possibly damaging 0.52
R0610:Olfr955 UTSW 9 39469823 missense probably damaging 0.98
R1420:Olfr955 UTSW 9 39469993 missense probably damaging 1.00
R1636:Olfr955 UTSW 9 39469919 missense probably benign 0.03
R1937:Olfr955 UTSW 9 39470037 missense possibly damaging 0.63
R2655:Olfr955 UTSW 9 39470628 missense probably benign
R2944:Olfr955 UTSW 9 39469938 missense possibly damaging 0.52
R3788:Olfr955 UTSW 9 39470069 missense probably benign 0.03
R4829:Olfr955 UTSW 9 39470367 missense probably damaging 0.99
R5625:Olfr955 UTSW 9 39469803 missense probably benign
R6168:Olfr955 UTSW 9 39470657 missense probably damaging 1.00
R6383:Olfr955 UTSW 9 39470630 missense probably damaging 1.00
R6418:Olfr955 UTSW 9 39469816 missense probably benign 0.07
R6645:Olfr955 UTSW 9 39470266 missense probably benign 0.03
R7062:Olfr955 UTSW 9 39470057 missense probably benign
R7765:Olfr955 UTSW 9 39470316 missense probably benign 0.28
R8122:Olfr955 UTSW 9 39470526 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGCACTGATTAAGCCAATACC -3'
(R):5'- CAGAGAATCCAGAGCTCCAG -3'

Sequencing Primer
(F):5'- ACAGACTTGATAGGACATGGTTAC -3'
(R):5'- GAATCCAGAGCTCCAGTTGCC -3'
Posted On2019-12-20