Incidental Mutation 'R7847:Ttyh2'
ID606697
Institutional Source Beutler Lab
Gene Symbol Ttyh2
Ensembl Gene ENSMUSG00000034714
Gene Nametweety family member 2
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.078) question?
Stock #R7847 (G1)
Quality Score203.009
Status Validated
Chromosome11
Chromosomal Location114675431-114720977 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 114675674 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000037821 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045779] [ENSMUST00000077915] [ENSMUST00000082092] [ENSMUST00000106599] [ENSMUST00000106602]
Predicted Effect probably null
Transcript: ENSMUST00000045779
SMART Domains Protein: ENSMUSP00000037821
Gene: ENSMUSG00000034714

DomainStartEndE-ValueType
Pfam:Tweety 27 433 2.5e-184 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000077915
SMART Domains Protein: ENSMUSP00000102211
Gene: ENSMUSG00000057322

DomainStartEndE-ValueType
Pfam:Ribosomal_L38e 2 69 1.6e-36 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000082092
SMART Domains Protein: ENSMUSP00000080741
Gene: ENSMUSG00000057322

DomainStartEndE-ValueType
Pfam:Ribosomal_L38e 2 69 1.6e-36 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106599
SMART Domains Protein: ENSMUSP00000102209
Gene: ENSMUSG00000057322

DomainStartEndE-ValueType
Pfam:Ribosomal_L38e 2 69 1.6e-36 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106602
SMART Domains Protein: ENSMUSP00000102213
Gene: ENSMUSG00000057322

DomainStartEndE-ValueType
Pfam:Ribosomal_L38e 2 69 3.9e-40 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (45/45)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the tweety family of proteins. Members of this family function as chloride anion channels. The encoded protein functions as a calcium(2+)-activated large conductance chloride(-) channel, and may play a role in kidney tumorigenesis. Two transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2300002M23Rik T A 17: 35,568,652 Y296N probably benign Het
Abcc4 T C 14: 118,627,480 E378G probably damaging Het
Acp2 C T 2: 91,210,732 H422Y possibly damaging Het
Aldoart1 C T 4: 72,851,956 C205Y probably damaging Het
Alg9 T C 9: 50,789,605 L225S possibly damaging Het
Anapc1 A C 2: 128,669,908 V455G possibly damaging Het
Arhgef5 C A 6: 43,275,135 S940* probably null Het
Asb15 C A 6: 24,564,267 A240E probably damaging Het
BB014433 GCACACAGCTTTGGAGGTGTACACACCCGGGTTGGGGCCTCTACACACAGCTTTGGAGGTGTACACACCCGGGTTGGGGCCTCTGCACACAGCTTTGG GCACACAGCTTTGGAGGTGTACACACCCGGGTTGGGGCCTCTGCACACAGCTTTGG 8: 15,042,160 probably benign Het
Ccdc17 A G 4: 116,599,906 E529G probably benign Het
Cyp2b10 T C 7: 25,897,760 S26P possibly damaging Het
Dcp1b T C 6: 119,215,295 S391P probably benign Het
Dock6 A T 9: 21,801,207 L2086Q unknown Het
Ephx1 A G 1: 181,001,861 S41P probably benign Het
Erbb3 G A 10: 128,571,189 T1034M probably damaging Het
Gm17334 T A 11: 53,772,738 probably benign Het
Golgb1 A G 16: 36,931,920 H3227R probably damaging Het
Grin2c G A 11: 115,260,978 P52L possibly damaging Het
Herc2 T C 7: 56,157,560 probably null Het
Il17rb A G 14: 29,996,806 Y440H probably damaging Het
Kcng4 A G 8: 119,626,142 L343P probably damaging Het
Knl1 G A 2: 119,070,976 E1053K probably benign Het
Lipo4 A T 19: 33,514,199 V128E possibly damaging Het
Lmntd2 T C 7: 141,210,150 N650D probably benign Het
Lrrfip2 T C 9: 111,213,880 L460P probably damaging Het
Man2a2 G C 7: 80,368,865 A82G probably benign Het
Mtcl1 T C 17: 66,344,333 Q1379R probably damaging Het
Mtfr2 G A 10: 20,357,452 A256T probably benign Het
Mup17 T A 4: 61,593,219 H159L probably benign Het
Ndufaf1 A T 2: 119,660,053 D175E probably damaging Het
Nup210l A G 3: 90,151,123 M610V probably benign Het
Olfr1338 G T 4: 118,754,368 H59N possibly damaging Het
Olfr1354 T A 10: 78,916,896 S19T probably benign Het
Olfr955 A G 9: 39,470,505 S74P probably benign Het
Pard3b A G 1: 62,343,934 D729G probably benign Het
Phactr1 T C 13: 43,057,188 L169P possibly damaging Het
Rad54b T A 4: 11,612,655 S762R probably damaging Het
Senp5 C T 16: 31,990,173 V88I probably benign Het
Specc1l T C 10: 75,309,836 V1105A probably damaging Het
Trak2 A C 1: 58,935,818 S72A possibly damaging Het
Ush2a G A 1: 188,430,808 C1029Y probably damaging Het
Vmn2r17 A G 5: 109,420,197 Y62C probably damaging Het
Vmn2r41 A G 7: 8,161,548 F2L probably benign Het
Xirp1 G T 9: 120,019,753 D21E possibly damaging Het
Zfp114 C A 7: 24,181,035 Q270K possibly damaging Het
Zfp341 T C 2: 154,634,194 S441P probably damaging Het
Zfp780b A C 7: 27,964,418 H237Q probably benign Het
Other mutations in Ttyh2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03048:Ttyh2 UTSW 11 114696695 missense probably benign 0.38
IGL03050:Ttyh2 UTSW 11 114708854 missense probably damaging 1.00
R0088:Ttyh2 UTSW 11 114690255 missense probably damaging 1.00
R0734:Ttyh2 UTSW 11 114710193 splice site probably benign
R1163:Ttyh2 UTSW 11 114710888 missense probably benign
R1433:Ttyh2 UTSW 11 114710179 missense probably benign 0.03
R1531:Ttyh2 UTSW 11 114686452 missense probably damaging 1.00
R1709:Ttyh2 UTSW 11 114708475 missense probably damaging 1.00
R3709:Ttyh2 UTSW 11 114719132 missense possibly damaging 0.68
R4497:Ttyh2 UTSW 11 114710963 missense possibly damaging 0.94
R4641:Ttyh2 UTSW 11 114701783 missense probably damaging 1.00
R4970:Ttyh2 UTSW 11 114696757 missense probably benign 0.00
R5112:Ttyh2 UTSW 11 114696757 missense probably benign 0.00
R5328:Ttyh2 UTSW 11 114710068 missense possibly damaging 0.90
R5587:Ttyh2 UTSW 11 114675659 missense probably benign 0.01
R5744:Ttyh2 UTSW 11 114702310 critical splice donor site probably null
R6302:Ttyh2 UTSW 11 114701836 missense probably damaging 1.00
R7890:Ttyh2 UTSW 11 114686446 missense possibly damaging 0.68
R7930:Ttyh2 UTSW 11 114675674 critical splice donor site probably null
R7973:Ttyh2 UTSW 11 114686446 missense possibly damaging 0.68
Predicted Primers PCR Primer
(F):5'- CCAGGAATTGGCTCAAGAGG -3'
(R):5'- TCCGAGATTTCCAGCTAGGTC -3'

Sequencing Primer
(F):5'- TGAGCAGAGCCTCGTGCATG -3'
(R):5'- TAGGTCGAGCGTCCCGG -3'
Posted On2019-12-20