Incidental Mutation 'R7847:Grin2c'
ID606698
Institutional Source Beutler Lab
Gene Symbol Grin2c
Ensembl Gene ENSMUSG00000020734
Gene Nameglutamate receptor, ionotropic, NMDA2C (epsilon 3)
SynonymsNR2C, GluRepsilon3, NMDAR2C
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.183) question?
Stock #R7847 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location115249169-115267243 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 115260978 bp
ZygosityHeterozygous
Amino Acid Change Proline to Leucine at position 52 (P52L)
Ref Sequence ENSEMBL: ENSMUSP00000003351 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003351] [ENSMUST00000106554]
Predicted Effect possibly damaging
Transcript: ENSMUST00000003351
AA Change: P52L

PolyPhen 2 Score 0.675 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000003351
Gene: ENSMUSG00000020734
AA Change: P52L

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:ANF_receptor 99 299 5.1e-12 PFAM
PBPe 440 796 1.11e-79 SMART
Lig_chan-Glu_bd 448 500 2.79e-18 SMART
transmembrane domain 816 835 N/A INTRINSIC
Pfam:NMDAR2_C 837 924 6.8e-15 PFAM
low complexity region 941 975 N/A INTRINSIC
low complexity region 1041 1058 N/A INTRINSIC
low complexity region 1063 1076 N/A INTRINSIC
low complexity region 1173 1182 N/A INTRINSIC
low complexity region 1194 1203 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000106554
AA Change: P52L

PolyPhen 2 Score 0.675 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000102164
Gene: ENSMUSG00000020734
AA Change: P52L

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:ANF_receptor 100 306 6.9e-10 PFAM
PBPe 440 796 1.11e-79 SMART
Lig_chan-Glu_bd 448 500 2.79e-18 SMART
transmembrane domain 816 835 N/A INTRINSIC
Pfam:NMDAR2_C 837 926 1.1e-13 PFAM
low complexity region 941 975 N/A INTRINSIC
low complexity region 1041 1058 N/A INTRINSIC
low complexity region 1063 1076 N/A INTRINSIC
low complexity region 1173 1182 N/A INTRINSIC
low complexity region 1194 1203 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (45/45)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of the N-methyl-D-aspartate (NMDA) receptor, which is a subtype of ionotropic glutamate receptor. NMDA receptors are found in the central nervous system, are permeable to cations and have an important role in physiological processes such as learning, memory, and synaptic development. The receptor is a tetramer of different subunits (typically heterodimer of subunit 1 with one or more of subunits 2A-D), forming a channel that is permeable to calcium, potassium, and sodium, and whose properties are determined by subunit composition. Alterations in the subunit composition of the receptor are associated with pathophysiological conditions such as Parkinson's disease, Alzheimer's disease, depression, and schizophrenia. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jun 2013]
PHENOTYPE: Homozygotes for targeted null mutations exhibit deficits in motor coordination and reduced granule cell responses to N-methy-D-aspartate in brain slices. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2300002M23Rik T A 17: 35,568,652 Y296N probably benign Het
Abcc4 T C 14: 118,627,480 E378G probably damaging Het
Acp2 C T 2: 91,210,732 H422Y possibly damaging Het
Aldoart1 C T 4: 72,851,956 C205Y probably damaging Het
Alg9 T C 9: 50,789,605 L225S possibly damaging Het
Anapc1 A C 2: 128,669,908 V455G possibly damaging Het
Arhgef5 C A 6: 43,275,135 S940* probably null Het
Asb15 C A 6: 24,564,267 A240E probably damaging Het
BB014433 GCACACAGCTTTGGAGGTGTACACACCCGGGTTGGGGCCTCTACACACAGCTTTGGAGGTGTACACACCCGGGTTGGGGCCTCTGCACACAGCTTTGG GCACACAGCTTTGGAGGTGTACACACCCGGGTTGGGGCCTCTGCACACAGCTTTGG 8: 15,042,160 probably benign Het
Ccdc17 A G 4: 116,599,906 E529G probably benign Het
Cyp2b10 T C 7: 25,897,760 S26P possibly damaging Het
Dcp1b T C 6: 119,215,295 S391P probably benign Het
Dock6 A T 9: 21,801,207 L2086Q unknown Het
Ephx1 A G 1: 181,001,861 S41P probably benign Het
Erbb3 G A 10: 128,571,189 T1034M probably damaging Het
Gm17334 T A 11: 53,772,738 probably benign Het
Golgb1 A G 16: 36,931,920 H3227R probably damaging Het
Herc2 T C 7: 56,157,560 probably null Het
Il17rb A G 14: 29,996,806 Y440H probably damaging Het
Kcng4 A G 8: 119,626,142 L343P probably damaging Het
Knl1 G A 2: 119,070,976 E1053K probably benign Het
Lipo4 A T 19: 33,514,199 V128E possibly damaging Het
Lmntd2 T C 7: 141,210,150 N650D probably benign Het
Lrrfip2 T C 9: 111,213,880 L460P probably damaging Het
Man2a2 G C 7: 80,368,865 A82G probably benign Het
Mtcl1 T C 17: 66,344,333 Q1379R probably damaging Het
Mtfr2 G A 10: 20,357,452 A256T probably benign Het
Mup17 T A 4: 61,593,219 H159L probably benign Het
Ndufaf1 A T 2: 119,660,053 D175E probably damaging Het
Nup210l A G 3: 90,151,123 M610V probably benign Het
Olfr1338 G T 4: 118,754,368 H59N possibly damaging Het
Olfr1354 T A 10: 78,916,896 S19T probably benign Het
Olfr955 A G 9: 39,470,505 S74P probably benign Het
Pard3b A G 1: 62,343,934 D729G probably benign Het
Phactr1 T C 13: 43,057,188 L169P possibly damaging Het
Rad54b T A 4: 11,612,655 S762R probably damaging Het
Senp5 C T 16: 31,990,173 V88I probably benign Het
Specc1l T C 10: 75,309,836 V1105A probably damaging Het
Trak2 A C 1: 58,935,818 S72A possibly damaging Het
Ttyh2 T C 11: 114,675,674 probably null Het
Ush2a G A 1: 188,430,808 C1029Y probably damaging Het
Vmn2r17 A G 5: 109,420,197 Y62C probably damaging Het
Vmn2r41 A G 7: 8,161,548 F2L probably benign Het
Xirp1 G T 9: 120,019,753 D21E possibly damaging Het
Zfp114 C A 7: 24,181,035 Q270K possibly damaging Het
Zfp341 T C 2: 154,634,194 S441P probably damaging Het
Zfp780b A C 7: 27,964,418 H237Q probably benign Het
Other mutations in Grin2c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01019:Grin2c APN 11 115258110 missense possibly damaging 0.94
IGL01306:Grin2c APN 11 115256194 missense probably benign 0.01
IGL01408:Grin2c APN 11 115260882 missense probably damaging 1.00
IGL01539:Grin2c APN 11 115250106 missense probably benign 0.32
IGL01931:Grin2c APN 11 115253910 missense probably damaging 1.00
IGL01964:Grin2c APN 11 115253847 missense probably damaging 1.00
IGL02796:Grin2c APN 11 115250717 splice site probably benign
IGL02956:Grin2c APN 11 115257959 missense possibly damaging 0.86
IGL03221:Grin2c APN 11 115254044 splice site probably benign
ANU23:Grin2c UTSW 11 115256194 missense probably benign 0.01
BB007:Grin2c UTSW 11 115256237 missense probably benign 0.01
BB017:Grin2c UTSW 11 115256237 missense probably benign 0.01
PIT4362001:Grin2c UTSW 11 115249633 missense probably benign
R0011:Grin2c UTSW 11 115255750 missense probably damaging 1.00
R0011:Grin2c UTSW 11 115255750 missense probably damaging 1.00
R0112:Grin2c UTSW 11 115251134 missense probably damaging 1.00
R0355:Grin2c UTSW 11 115260728 splice site probably benign
R0681:Grin2c UTSW 11 115249653 missense probably benign
R0791:Grin2c UTSW 11 115250646 missense probably damaging 1.00
R0792:Grin2c UTSW 11 115250646 missense probably damaging 1.00
R1512:Grin2c UTSW 11 115253850 missense probably damaging 1.00
R1572:Grin2c UTSW 11 115256074 missense possibly damaging 0.92
R1654:Grin2c UTSW 11 115260853 missense probably benign 0.21
R1803:Grin2c UTSW 11 115260732 critical splice donor site probably null
R1982:Grin2c UTSW 11 115260905 missense possibly damaging 0.96
R2050:Grin2c UTSW 11 115257419 missense possibly damaging 0.89
R2196:Grin2c UTSW 11 115250666 missense probably benign 0.34
R2442:Grin2c UTSW 11 115251134 missense probably damaging 1.00
R2509:Grin2c UTSW 11 115251068 nonsense probably null
R3440:Grin2c UTSW 11 115250643 missense probably damaging 1.00
R3965:Grin2c UTSW 11 115260994 missense probably damaging 1.00
R4618:Grin2c UTSW 11 115252747 missense probably damaging 1.00
R4735:Grin2c UTSW 11 115249596 missense possibly damaging 0.63
R4856:Grin2c UTSW 11 115260790 missense probably damaging 1.00
R4886:Grin2c UTSW 11 115260790 missense probably damaging 1.00
R5277:Grin2c UTSW 11 115253813 missense probably damaging 1.00
R5334:Grin2c UTSW 11 115256055 missense possibly damaging 0.76
R5553:Grin2c UTSW 11 115252725 missense probably null 0.96
R5711:Grin2c UTSW 11 115250289 missense probably benign 0.32
R5784:Grin2c UTSW 11 115258295 missense possibly damaging 0.94
R5849:Grin2c UTSW 11 115260991 missense probably benign
R6421:Grin2c UTSW 11 115251130 missense probably damaging 1.00
R6461:Grin2c UTSW 11 115255696 missense possibly damaging 0.96
R6658:Grin2c UTSW 11 115258282 missense possibly damaging 0.64
R7205:Grin2c UTSW 11 115251050 missense probably damaging 0.99
R7611:Grin2c UTSW 11 115252685 missense probably damaging 1.00
R7637:Grin2c UTSW 11 115256259 splice site probably null
R7751:Grin2c UTSW 11 115253870 missense probably damaging 1.00
R7930:Grin2c UTSW 11 115256237 missense probably benign 0.01
R8081:Grin2c UTSW 11 115249893 missense probably damaging 0.98
R8249:Grin2c UTSW 11 115253837 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TCCACTGATGCTGAGGATGG -3'
(R):5'- CTGATTTCTCTGCAGGACCC -3'

Sequencing Primer
(F):5'- TGCTGAGGATGGGCACG -3'
(R):5'- AGGACCCTCCAGTGGACATG -3'
Posted On2019-12-20