Incidental Mutation 'R7847:Il17rb'
ID606700
Institutional Source Beutler Lab
Gene Symbol Il17rb
Ensembl Gene ENSMUSG00000015966
Gene Nameinterleukin 17 receptor B
SynonymsIL17RH1, Evi27, IL-17Rh1, IL-17ER, Il17br
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.068) question?
Stock #R7847 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location29996135-30008896 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 29996806 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 440 (Y440H)
Ref Sequence ENSEMBL: ENSMUSP00000016110 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000016110] [ENSMUST00000016115] [ENSMUST00000122205] [ENSMUST00000135888] [ENSMUST00000136726] [ENSMUST00000224797]
PDB Structure
Crystal Structure of iL-17 receptor B SEFIR domain [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000016110
AA Change: Y440H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000016110
Gene: ENSMUSG00000015966
AA Change: Y440H

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Pfam:IL17R_fnIII_D1 22 175 4.3e-26 PFAM
Pfam:IL17R_fnIII_D2 176 268 1.3e-11 PFAM
transmembrane domain 287 309 N/A INTRINSIC
Pfam:SEFIR 329 476 3.5e-49 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000016115
SMART Domains Protein: ENSMUSP00000016115
Gene: ENSMUSG00000015971

DomainStartEndE-ValueType
low complexity region 5 27 N/A INTRINSIC
ACTIN 46 621 3.34e-11 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000122205
AA Change: Y440H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113686
Gene: ENSMUSG00000015966
AA Change: Y440H

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
PDB:4HSA|F 34 276 2e-23 PDB
transmembrane domain 287 309 N/A INTRINSIC
Pfam:SEFIR 329 476 1.7e-49 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000135888
SMART Domains Protein: ENSMUSP00000121407
Gene: ENSMUSG00000015966

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Pfam:IL17R_fnIII_D1 22 123 1.1e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000136726
SMART Domains Protein: ENSMUSP00000117802
Gene: ENSMUSG00000015966

DomainStartEndE-ValueType
PDB:3JVF|C 13 171 5e-12 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000224797
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (45/45)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a cytokine receptor. This receptor specifically binds to IL17B and IL17E, but does not bind to IL17 and IL17C. This receptor has been shown to mediate the activation of NF-kappaB and the production of IL8 induced by IL17E. The expression of the rat counterpart of this gene was found to be significantly up-regulated during intestinal inflammation, which suggested the immunoregulatory activity of this receptor. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice that are homozygous for a null allele have defects in their response to IL17A or IL17F. In addition this locus is a common site of retoviral integration in BXH2 murine myeloid leukemias and occurred at a CpG island 6 kb upstream of the Il17rb gene. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2300002M23Rik T A 17: 35,568,652 Y296N probably benign Het
Abcc4 T C 14: 118,627,480 E378G probably damaging Het
Acp2 C T 2: 91,210,732 H422Y possibly damaging Het
Aldoart1 C T 4: 72,851,956 C205Y probably damaging Het
Alg9 T C 9: 50,789,605 L225S possibly damaging Het
Anapc1 A C 2: 128,669,908 V455G possibly damaging Het
Arhgef5 C A 6: 43,275,135 S940* probably null Het
Asb15 C A 6: 24,564,267 A240E probably damaging Het
BB014433 GCACACAGCTTTGGAGGTGTACACACCCGGGTTGGGGCCTCTACACACAGCTTTGGAGGTGTACACACCCGGGTTGGGGCCTCTGCACACAGCTTTGG GCACACAGCTTTGGAGGTGTACACACCCGGGTTGGGGCCTCTGCACACAGCTTTGG 8: 15,042,160 probably benign Het
Ccdc17 A G 4: 116,599,906 E529G probably benign Het
Cyp2b10 T C 7: 25,897,760 S26P possibly damaging Het
Dcp1b T C 6: 119,215,295 S391P probably benign Het
Dock6 A T 9: 21,801,207 L2086Q unknown Het
Ephx1 A G 1: 181,001,861 S41P probably benign Het
Erbb3 G A 10: 128,571,189 T1034M probably damaging Het
Gm17334 T A 11: 53,772,738 probably benign Het
Golgb1 A G 16: 36,931,920 H3227R probably damaging Het
Grin2c G A 11: 115,260,978 P52L possibly damaging Het
Herc2 T C 7: 56,157,560 probably null Het
Kcng4 A G 8: 119,626,142 L343P probably damaging Het
Knl1 G A 2: 119,070,976 E1053K probably benign Het
Lipo4 A T 19: 33,514,199 V128E possibly damaging Het
Lmntd2 T C 7: 141,210,150 N650D probably benign Het
Lrrfip2 T C 9: 111,213,880 L460P probably damaging Het
Man2a2 G C 7: 80,368,865 A82G probably benign Het
Mtcl1 T C 17: 66,344,333 Q1379R probably damaging Het
Mtfr2 G A 10: 20,357,452 A256T probably benign Het
Mup17 T A 4: 61,593,219 H159L probably benign Het
Ndufaf1 A T 2: 119,660,053 D175E probably damaging Het
Nup210l A G 3: 90,151,123 M610V probably benign Het
Olfr1338 G T 4: 118,754,368 H59N possibly damaging Het
Olfr1354 T A 10: 78,916,896 S19T probably benign Het
Olfr955 A G 9: 39,470,505 S74P probably benign Het
Pard3b A G 1: 62,343,934 D729G probably benign Het
Phactr1 T C 13: 43,057,188 L169P possibly damaging Het
Rad54b T A 4: 11,612,655 S762R probably damaging Het
Senp5 C T 16: 31,990,173 V88I probably benign Het
Specc1l T C 10: 75,309,836 V1105A probably damaging Het
Trak2 A C 1: 58,935,818 S72A possibly damaging Het
Ttyh2 T C 11: 114,675,674 probably null Het
Ush2a G A 1: 188,430,808 C1029Y probably damaging Het
Vmn2r17 A G 5: 109,420,197 Y62C probably damaging Het
Vmn2r41 A G 7: 8,161,548 F2L probably benign Het
Xirp1 G T 9: 120,019,753 D21E possibly damaging Het
Zfp114 C A 7: 24,181,035 Q270K possibly damaging Het
Zfp341 T C 2: 154,634,194 S441P probably damaging Het
Zfp780b A C 7: 27,964,418 H237Q probably benign Het
Other mutations in Il17rb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01584:Il17rb APN 14 30003680 missense probably damaging 1.00
IGL03151:Il17rb APN 14 30006853 missense probably benign 0.05
R0276:Il17rb UTSW 14 30004380 missense probably damaging 1.00
R0391:Il17rb UTSW 14 30004347 missense probably benign 0.00
R0391:Il17rb UTSW 14 30006155 unclassified probably null
R0408:Il17rb UTSW 14 29996680 missense probably benign 0.02
R2011:Il17rb UTSW 14 29996840 nonsense probably null
R2012:Il17rb UTSW 14 29996840 nonsense probably null
R2057:Il17rb UTSW 14 29997154 missense probably benign 0.01
R2227:Il17rb UTSW 14 30006081 missense probably benign 0.02
R3548:Il17rb UTSW 14 30008772 unclassified probably null
R4199:Il17rb UTSW 14 29996644 missense probably benign
R4578:Il17rb UTSW 14 30002399 missense probably damaging 0.97
R5092:Il17rb UTSW 14 30002376 missense probably benign 0.00
R5928:Il17rb UTSW 14 30004275 critical splice donor site probably null
R6280:Il17rb UTSW 14 30002971 missense probably benign 0.00
R6378:Il17rb UTSW 14 30000363 missense probably damaging 0.97
R6470:Il17rb UTSW 14 30002909 missense probably benign 0.10
R6741:Il17rb UTSW 14 30000336 missense possibly damaging 0.82
R6919:Il17rb UTSW 14 30004271 splice site probably null
R7133:Il17rb UTSW 14 29996871 missense probably damaging 1.00
R7423:Il17rb UTSW 14 29997115 missense probably damaging 0.97
R7470:Il17rb UTSW 14 29998033 missense probably damaging 1.00
R7559:Il17rb UTSW 14 29997043 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTAGGAAGGCTTCAGAGTCTC -3'
(R):5'- TGACCACTCAGAAGCAAGCG -3'

Sequencing Primer
(F):5'- AGGAAGGCTTCAGAGTCTCTATTCC -3'
(R):5'- CGGCAGATAAAGTGGTCTTCC -3'
Posted On2019-12-20