Incidental Mutation 'R7847:Abcc4'
ID606701
Institutional Source Beutler Lab
Gene Symbol Abcc4
Ensembl Gene ENSMUSG00000032849
Gene NameATP-binding cassette, sub-family C (CFTR/MRP), member 4
SynonymsMRP4, D630049P08Rik, MOAT-B
Accession Numbers

Genbank: NM_001033336.3, NM_001163675.1, NM_001163676.1; Ensembl: ENSMUST00000036554

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7847 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location118482692-118706219 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 118627480 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 378 (E378G)
Ref Sequence ENSEMBL: ENSMUSP00000042186 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036554] [ENSMUST00000166646]
Predicted Effect probably damaging
Transcript: ENSMUST00000036554
AA Change: E378G

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000042186
Gene: ENSMUSG00000032849
AA Change: E378G

DomainStartEndE-ValueType
Pfam:ABC_membrane 92 365 4.5e-37 PFAM
AAA 437 610 5.71e-12 SMART
Pfam:ABC_membrane 714 993 4.2e-47 PFAM
AAA 1067 1251 2.02e-12 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000166646
AA Change: E303G

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000129677
Gene: ENSMUSG00000032849
AA Change: E303G

DomainStartEndE-ValueType
Pfam:ABC_membrane 98 290 4.1e-22 PFAM
AAA 362 535 5.71e-12 SMART
Pfam:ABC_membrane 638 922 4.6e-39 PFAM
AAA 992 1176 2.02e-12 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (45/45)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the MRP subfamily which is involved in multi-drug resistance. This family member plays a role in cellular detoxification as a pump for its substrate, organic anions. It may also function in prostaglandin-mediated cAMP signaling in ciliogenesis. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Sep 2014]
PHENOTYPE: Homozygous null mice are viable and fertile. Homozygotes for one null allele display impaired organic anion transport in the blood-brain and blood-cerebrospinal fluid barriers and kidney. Homozygotes for a second null allele display hypoalgesia and abnormal PGE2 physiology. [provided by MGI curators]
Allele List at MGI

All alleles(143) : Targeted, knock-out(2) Gene trapped(141)

Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2300002M23Rik T A 17: 35,568,652 Y296N probably benign Het
Acp2 C T 2: 91,210,732 H422Y possibly damaging Het
Aldoart1 C T 4: 72,851,956 C205Y probably damaging Het
Alg9 T C 9: 50,789,605 L225S possibly damaging Het
Anapc1 A C 2: 128,669,908 V455G possibly damaging Het
Arhgef5 C A 6: 43,275,135 S940* probably null Het
Asb15 C A 6: 24,564,267 A240E probably damaging Het
BB014433 GCACACAGCTTTGGAGGTGTACACACCCGGGTTGGGGCCTCTACACACAGCTTTGGAGGTGTACACACCCGGGTTGGGGCCTCTGCACACAGCTTTGG GCACACAGCTTTGGAGGTGTACACACCCGGGTTGGGGCCTCTGCACACAGCTTTGG 8: 15,042,160 probably benign Het
Ccdc17 A G 4: 116,599,906 E529G probably benign Het
Cyp2b10 T C 7: 25,897,760 S26P possibly damaging Het
Dcp1b T C 6: 119,215,295 S391P probably benign Het
Dock6 A T 9: 21,801,207 L2086Q unknown Het
Ephx1 A G 1: 181,001,861 S41P probably benign Het
Erbb3 G A 10: 128,571,189 T1034M probably damaging Het
Gm17334 T A 11: 53,772,738 probably benign Het
Golgb1 A G 16: 36,931,920 H3227R probably damaging Het
Grin2c G A 11: 115,260,978 P52L possibly damaging Het
Herc2 T C 7: 56,157,560 probably null Het
Il17rb A G 14: 29,996,806 Y440H probably damaging Het
Kcng4 A G 8: 119,626,142 L343P probably damaging Het
Knl1 G A 2: 119,070,976 E1053K probably benign Het
Lipo4 A T 19: 33,514,199 V128E possibly damaging Het
Lmntd2 T C 7: 141,210,150 N650D probably benign Het
Lrrfip2 T C 9: 111,213,880 L460P probably damaging Het
Man2a2 G C 7: 80,368,865 A82G probably benign Het
Mtcl1 T C 17: 66,344,333 Q1379R probably damaging Het
Mtfr2 G A 10: 20,357,452 A256T probably benign Het
Mup17 T A 4: 61,593,219 H159L probably benign Het
Ndufaf1 A T 2: 119,660,053 D175E probably damaging Het
Nup210l A G 3: 90,151,123 M610V probably benign Het
Olfr1338 G T 4: 118,754,368 H59N possibly damaging Het
Olfr1354 T A 10: 78,916,896 S19T probably benign Het
Olfr955 A G 9: 39,470,505 S74P probably benign Het
Pard3b A G 1: 62,343,934 D729G probably benign Het
Phactr1 T C 13: 43,057,188 L169P possibly damaging Het
Rad54b T A 4: 11,612,655 S762R probably damaging Het
Senp5 C T 16: 31,990,173 V88I probably benign Het
Specc1l T C 10: 75,309,836 V1105A probably damaging Het
Trak2 A C 1: 58,935,818 S72A possibly damaging Het
Ttyh2 T C 11: 114,675,674 probably null Het
Ush2a G A 1: 188,430,808 C1029Y probably damaging Het
Vmn2r17 A G 5: 109,420,197 Y62C probably damaging Het
Vmn2r41 A G 7: 8,161,548 F2L probably benign Het
Xirp1 G T 9: 120,019,753 D21E possibly damaging Het
Zfp114 C A 7: 24,181,035 Q270K possibly damaging Het
Zfp341 T C 2: 154,634,194 S441P probably damaging Het
Zfp780b A C 7: 27,964,418 H237Q probably benign Het
Other mutations in Abcc4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00768:Abcc4 APN 14 118528997 missense probably benign 0.03
IGL01152:Abcc4 APN 14 118599385 missense probably damaging 1.00
IGL01511:Abcc4 APN 14 118599341 missense probably benign 0.03
IGL01604:Abcc4 APN 14 118527994 missense possibly damaging 0.94
IGL01725:Abcc4 APN 14 118500829 missense probably damaging 1.00
IGL01828:Abcc4 APN 14 118553279 splice site probably benign
IGL02174:Abcc4 APN 14 118500742 missense probably damaging 0.98
IGL02391:Abcc4 APN 14 118553352 missense probably damaging 1.00
IGL02500:Abcc4 APN 14 118618926 missense possibly damaging 0.47
IGL02598:Abcc4 APN 14 118668369 nonsense probably null
IGL02668:Abcc4 APN 14 118611475 missense probably damaging 1.00
IGL02708:Abcc4 APN 14 118500801 missense probably damaging 1.00
IGL02859:Abcc4 APN 14 118516500 missense probably damaging 1.00
IGL03249:Abcc4 APN 14 118627706 splice site probably benign
IGL03257:Abcc4 APN 14 118615211 missense probably benign 0.01
IGL03298:Abcc4 APN 14 118611468 missense probably damaging 1.00
1mM(1):Abcc4 UTSW 14 118629656 nonsense probably null
R0743:Abcc4 UTSW 14 118553288 missense possibly damaging 0.90
R0884:Abcc4 UTSW 14 118553288 missense possibly damaging 0.90
R1139:Abcc4 UTSW 14 118500840 missense possibly damaging 0.56
R1238:Abcc4 UTSW 14 118597639 splice site probably benign
R1588:Abcc4 UTSW 14 118534072 missense probably benign 0.01
R1678:Abcc4 UTSW 14 118594894 missense probably benign 0.08
R1785:Abcc4 UTSW 14 118553349 missense probably damaging 0.99
R1786:Abcc4 UTSW 14 118553349 missense probably damaging 0.99
R1961:Abcc4 UTSW 14 118611456 missense probably damaging 0.98
R1961:Abcc4 UTSW 14 118611459 missense possibly damaging 0.92
R1993:Abcc4 UTSW 14 118526282 missense probably benign 0.02
R2025:Abcc4 UTSW 14 118553325 missense probably benign 0.13
R3613:Abcc4 UTSW 14 118627451 critical splice donor site probably null
R3864:Abcc4 UTSW 14 118616415 missense probably benign
R4274:Abcc4 UTSW 14 118629622 missense probably damaging 1.00
R4459:Abcc4 UTSW 14 118599393 missense probably benign 0.11
R4601:Abcc4 UTSW 14 118632163 missense probably benign 0.00
R4665:Abcc4 UTSW 14 118529002 missense probably benign
R4678:Abcc4 UTSW 14 118627691 missense probably damaging 0.97
R4771:Abcc4 UTSW 14 118484384 missense probably benign 0.00
R4962:Abcc4 UTSW 14 118668399 missense probably benign 0.33
R4997:Abcc4 UTSW 14 118516503 nonsense probably null
R5273:Abcc4 UTSW 14 118594821 missense possibly damaging 0.76
R5526:Abcc4 UTSW 14 118631037 missense probably benign 0.10
R5652:Abcc4 UTSW 14 118618927 missense probably benign 0.00
R5820:Abcc4 UTSW 14 118604195 missense probably benign 0.14
R5873:Abcc4 UTSW 14 118526290 missense probably benign 0.00
R6008:Abcc4 UTSW 14 118490566 missense possibly damaging 0.63
R6080:Abcc4 UTSW 14 118669050 missense possibly damaging 0.75
R6222:Abcc4 UTSW 14 118529956 missense probably damaging 1.00
R6919:Abcc4 UTSW 14 118594894 missense probably benign 0.08
R6931:Abcc4 UTSW 14 118527988 missense probably damaging 0.99
R7013:Abcc4 UTSW 14 118526343 missense probably benign
R7055:Abcc4 UTSW 14 118594785 nonsense probably null
R7146:Abcc4 UTSW 14 118615181 missense probably damaging 1.00
R7365:Abcc4 UTSW 14 118627654 missense probably damaging 1.00
R7402:Abcc4 UTSW 14 118706075 missense probably damaging 1.00
R7438:Abcc4 UTSW 14 118616446 missense probably benign 0.01
R7528:Abcc4 UTSW 14 118529905 missense probably damaging 0.99
R7674:Abcc4 UTSW 14 118611487 missense probably damaging 1.00
R7769:Abcc4 UTSW 14 118615270 frame shift probably null
R7823:Abcc4 UTSW 14 118534072 missense probably benign 0.01
R8044:Abcc4 UTSW 14 118615270 frame shift probably null
R8214:Abcc4 UTSW 14 118500841 missense probably benign 0.35
R8264:Abcc4 UTSW 14 118594842 missense possibly damaging 0.81
R8309:Abcc4 UTSW 14 118616392 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TATTGTGCCCATGACAGATCAG -3'
(R):5'- CCTACCTCAGAGGGATGAACATG -3'

Sequencing Primer
(F):5'- TGTGCCCATGACAGATCAGAAATTC -3'
(R):5'- ATGAACATGGCGTCGTTTTTCATC -3'
Posted On2019-12-20