Incidental Mutation 'R7847:Golgb1'
ID 606703
Institutional Source Beutler Lab
Gene Symbol Golgb1
Ensembl Gene ENSMUSG00000034243
Gene Name golgin B1
Synonyms C130074L01Rik, Gm6840, F730017E11Rik, Giantin, 6330407A06Rik
MMRRC Submission 045901-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.908) question?
Stock # R7847 (G1)
Quality Score 225.009
Status Validated
Chromosome 16
Chromosomal Location 36695502-36753447 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 36752282 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Histidine to Arginine at position 3227 (H3227R)
Ref Sequence ENSEMBL: ENSMUSP00000045239 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023531] [ENSMUST00000039855] [ENSMUST00000114812]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000023531
SMART Domains Protein: ENSMUSP00000023531
Gene: ENSMUSG00000022831

DomainStartEndE-ValueType
Pfam:HS1_rep 82 117 6.6e-23 PFAM
Pfam:HS1_rep 119 154 1.2e-23 PFAM
Pfam:HS1_rep 156 191 3.3e-21 PFAM
Pfam:HS1_rep 193 220 2.1e-14 PFAM
coiled coil region 238 273 N/A INTRINSIC
low complexity region 358 390 N/A INTRINSIC
SH3 432 486 1.2e-19 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000039855
AA Change: H3227R

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000045239
Gene: ENSMUSG00000034243
AA Change: H3227R

DomainStartEndE-ValueType
internal_repeat_2 24 61 7.47e-6 PROSPERO
low complexity region 87 107 N/A INTRINSIC
coiled coil region 130 219 N/A INTRINSIC
low complexity region 491 512 N/A INTRINSIC
internal_repeat_3 519 558 7.47e-6 PROSPERO
coiled coil region 563 594 N/A INTRINSIC
internal_repeat_4 627 661 3.38e-5 PROSPERO
coiled coil region 679 1121 N/A INTRINSIC
coiled coil region 1153 1240 N/A INTRINSIC
internal_repeat_4 1253 1288 3.38e-5 PROSPERO
low complexity region 1300 1314 N/A INTRINSIC
internal_repeat_1 1321 1352 3.51e-6 PROSPERO
low complexity region 1357 1369 N/A INTRINSIC
coiled coil region 1402 1755 N/A INTRINSIC
internal_repeat_2 1760 1798 7.47e-6 PROSPERO
internal_repeat_3 1761 1804 7.47e-6 PROSPERO
coiled coil region 1818 2034 N/A INTRINSIC
low complexity region 2291 2306 N/A INTRINSIC
internal_repeat_1 2351 2382 3.51e-6 PROSPERO
low complexity region 2400 2418 N/A INTRINSIC
low complexity region 2538 2549 N/A INTRINSIC
coiled coil region 2775 2827 N/A INTRINSIC
coiled coil region 2854 2943 N/A INTRINSIC
low complexity region 2964 2976 N/A INTRINSIC
coiled coil region 3007 3057 N/A INTRINSIC
coiled coil region 3117 3163 N/A INTRINSIC
transmembrane domain 3215 3237 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000114812
AA Change: H3186R

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000110460
Gene: ENSMUSG00000034243
AA Change: H3186R

DomainStartEndE-ValueType
internal_repeat_2 24 61 6.71e-6 PROSPERO
low complexity region 87 107 N/A INTRINSIC
low complexity region 120 134 N/A INTRINSIC
low complexity region 143 154 N/A INTRINSIC
low complexity region 200 219 N/A INTRINSIC
low complexity region 450 471 N/A INTRINSIC
internal_repeat_3 478 517 6.71e-6 PROSPERO
coiled coil region 522 553 N/A INTRINSIC
internal_repeat_4 586 620 3.05e-5 PROSPERO
coiled coil region 638 1080 N/A INTRINSIC
coiled coil region 1112 1199 N/A INTRINSIC
internal_repeat_4 1212 1247 3.05e-5 PROSPERO
low complexity region 1259 1273 N/A INTRINSIC
internal_repeat_1 1280 1311 3.14e-6 PROSPERO
low complexity region 1316 1328 N/A INTRINSIC
coiled coil region 1361 1714 N/A INTRINSIC
internal_repeat_2 1719 1757 6.71e-6 PROSPERO
internal_repeat_3 1720 1763 6.71e-6 PROSPERO
coiled coil region 1777 1993 N/A INTRINSIC
low complexity region 2250 2265 N/A INTRINSIC
internal_repeat_1 2310 2341 3.14e-6 PROSPERO
low complexity region 2359 2377 N/A INTRINSIC
low complexity region 2497 2508 N/A INTRINSIC
coiled coil region 2734 2786 N/A INTRINSIC
coiled coil region 2813 2902 N/A INTRINSIC
low complexity region 2923 2935 N/A INTRINSIC
coiled coil region 2966 3016 N/A INTRINSIC
coiled coil region 3076 3122 N/A INTRINSIC
transmembrane domain 3174 3196 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (45/45)
MGI Phenotype PHENOTYPE: Homozygous knockout affects glycosylation of glycoproteins in the extra-cellular matrix of the palatal shelves, resulting in their failure to elevate and fuse, leading to cleft palate. [provided by MGI curators]
Allele List at MGI

All alleles(7) : Targeted, other(2) Gene trapped(5)

Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2300002M23Rik T A 17: 35,879,549 (GRCm39) Y296N probably benign Het
Abcc4 T C 14: 118,864,892 (GRCm39) E378G probably damaging Het
Acp2 C T 2: 91,041,077 (GRCm39) H422Y possibly damaging Het
Aldoart1 C T 4: 72,770,193 (GRCm39) C205Y probably damaging Het
Alg9 T C 9: 50,700,905 (GRCm39) L225S possibly damaging Het
Anapc1 A C 2: 128,511,828 (GRCm39) V455G possibly damaging Het
Arhgef5 C A 6: 43,252,069 (GRCm39) S940* probably null Het
Asb15 C A 6: 24,564,266 (GRCm39) A240E probably damaging Het
BB014433 GCACACAGCTTTGGAGGTGTACACACCCGGGTTGGGGCCTCTACACACAGCTTTGGAGGTGTACACACCCGGGTTGGGGCCTCTGCACACAGCTTTGG GCACACAGCTTTGGAGGTGTACACACCCGGGTTGGGGCCTCTGCACACAGCTTTGG 8: 15,092,160 (GRCm39) probably benign Het
Ccdc17 A G 4: 116,457,103 (GRCm39) E529G probably benign Het
Cyp2b10 T C 7: 25,597,185 (GRCm39) S26P possibly damaging Het
Dcp1b T C 6: 119,192,256 (GRCm39) S391P probably benign Het
Dock6 A T 9: 21,712,503 (GRCm39) L2086Q unknown Het
Ephx1 A G 1: 180,829,426 (GRCm39) S41P probably benign Het
Erbb3 G A 10: 128,407,058 (GRCm39) T1034M probably damaging Het
Gm17334 T A 11: 53,663,564 (GRCm39) probably benign Het
Grin2c G A 11: 115,151,804 (GRCm39) P52L possibly damaging Het
Herc2 T C 7: 55,807,308 (GRCm39) probably null Het
Il17rb A G 14: 29,718,763 (GRCm39) Y440H probably damaging Het
Kcng4 A G 8: 120,352,881 (GRCm39) L343P probably damaging Het
Knl1 G A 2: 118,901,457 (GRCm39) E1053K probably benign Het
Lipo4 A T 19: 33,491,599 (GRCm39) V128E possibly damaging Het
Lmntd2 T C 7: 140,790,063 (GRCm39) N650D probably benign Het
Lrrfip2 T C 9: 111,042,948 (GRCm39) L460P probably damaging Het
Man2a2 G C 7: 80,018,613 (GRCm39) A82G probably benign Het
Mtcl1 T C 17: 66,651,328 (GRCm39) Q1379R probably damaging Het
Mtfr2 G A 10: 20,233,198 (GRCm39) A256T probably benign Het
Mup17 T A 4: 61,511,456 (GRCm39) H159L probably benign Het
Ndufaf1 A T 2: 119,490,534 (GRCm39) D175E probably damaging Het
Nup210l A G 3: 90,058,430 (GRCm39) M610V probably benign Het
Or10ak14 G T 4: 118,611,565 (GRCm39) H59N possibly damaging Het
Or7a38 T A 10: 78,752,730 (GRCm39) S19T probably benign Het
Or8g35 A G 9: 39,381,801 (GRCm39) S74P probably benign Het
Pard3b A G 1: 62,383,093 (GRCm39) D729G probably benign Het
Phactr1 T C 13: 43,210,664 (GRCm39) L169P possibly damaging Het
Rad54b T A 4: 11,612,655 (GRCm39) S762R probably damaging Het
Senp5 C T 16: 31,808,991 (GRCm39) V88I probably benign Het
Specc1l T C 10: 75,145,670 (GRCm39) V1105A probably damaging Het
Trak2 A C 1: 58,974,977 (GRCm39) S72A possibly damaging Het
Ttyh2 T C 11: 114,566,500 (GRCm39) probably null Het
Ush2a G A 1: 188,163,005 (GRCm39) C1029Y probably damaging Het
Vmn2r17 A G 5: 109,568,063 (GRCm39) Y62C probably damaging Het
Vmn2r41 A G 7: 8,164,547 (GRCm39) F2L probably benign Het
Xirp1 G T 9: 119,848,819 (GRCm39) D21E possibly damaging Het
Zfp114 C A 7: 23,880,460 (GRCm39) Q270K possibly damaging Het
Zfp341 T C 2: 154,476,114 (GRCm39) S441P probably damaging Het
Zfp780b A C 7: 27,663,843 (GRCm39) H237Q probably benign Het
Other mutations in Golgb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01394:Golgb1 APN 16 36,751,926 (GRCm39) missense probably damaging 1.00
IGL01717:Golgb1 APN 16 36,735,864 (GRCm39) nonsense probably null
IGL01965:Golgb1 APN 16 36,738,282 (GRCm39) missense probably damaging 1.00
IGL02128:Golgb1 APN 16 36,736,666 (GRCm39) missense probably damaging 1.00
IGL02268:Golgb1 APN 16 36,733,490 (GRCm39) missense probably benign 0.25
IGL02383:Golgb1 APN 16 36,706,562 (GRCm39) missense probably benign 0.01
IGL02444:Golgb1 APN 16 36,728,178 (GRCm39) splice site probably benign
IGL02635:Golgb1 APN 16 36,735,375 (GRCm39) missense probably benign 0.00
IGL02655:Golgb1 APN 16 36,738,442 (GRCm39) missense probably damaging 0.98
IGL02887:Golgb1 APN 16 36,746,211 (GRCm39) missense probably damaging 0.99
IGL02937:Golgb1 APN 16 36,736,572 (GRCm39) missense probably damaging 1.00
IGL02973:Golgb1 APN 16 36,732,442 (GRCm39) missense possibly damaging 0.92
IGL02982:Golgb1 APN 16 36,746,172 (GRCm39) missense probably damaging 0.98
IGL03065:Golgb1 APN 16 36,733,228 (GRCm39) missense probably benign 0.11
IGL03109:Golgb1 APN 16 36,735,973 (GRCm39) missense possibly damaging 0.93
IGL03323:Golgb1 APN 16 36,733,815 (GRCm39) nonsense probably null
I2288:Golgb1 UTSW 16 36,718,904 (GRCm39) missense probably benign 0.00
I2289:Golgb1 UTSW 16 36,718,904 (GRCm39) missense probably benign 0.00
R0071:Golgb1 UTSW 16 36,735,865 (GRCm39) missense probably benign 0.00
R0071:Golgb1 UTSW 16 36,735,865 (GRCm39) missense probably benign 0.00
R0080:Golgb1 UTSW 16 36,718,973 (GRCm39) missense probably damaging 1.00
R0102:Golgb1 UTSW 16 36,695,830 (GRCm39) intron probably benign
R0242:Golgb1 UTSW 16 36,695,992 (GRCm39) nonsense probably null
R0242:Golgb1 UTSW 16 36,695,992 (GRCm39) nonsense probably null
R0276:Golgb1 UTSW 16 36,734,238 (GRCm39) missense probably damaging 1.00
R0394:Golgb1 UTSW 16 36,695,941 (GRCm39) intron probably benign
R0469:Golgb1 UTSW 16 36,751,997 (GRCm39) missense probably benign 0.41
R0522:Golgb1 UTSW 16 36,735,567 (GRCm39) frame shift probably null
R0575:Golgb1 UTSW 16 36,739,171 (GRCm39) missense probably benign
R0600:Golgb1 UTSW 16 36,736,633 (GRCm39) missense probably damaging 1.00
R0608:Golgb1 UTSW 16 36,736,692 (GRCm39) nonsense probably null
R0711:Golgb1 UTSW 16 36,739,152 (GRCm39) missense probably damaging 1.00
R0785:Golgb1 UTSW 16 36,719,152 (GRCm39) missense possibly damaging 0.95
R0893:Golgb1 UTSW 16 36,732,639 (GRCm39) missense possibly damaging 0.64
R1163:Golgb1 UTSW 16 36,736,488 (GRCm39) missense possibly damaging 0.50
R1208:Golgb1 UTSW 16 36,735,567 (GRCm39) frame shift probably null
R1315:Golgb1 UTSW 16 36,735,262 (GRCm39) missense probably benign 0.40
R1429:Golgb1 UTSW 16 36,720,925 (GRCm39) missense possibly damaging 0.93
R1505:Golgb1 UTSW 16 36,740,005 (GRCm39) missense possibly damaging 0.79
R1537:Golgb1 UTSW 16 36,719,150 (GRCm39) missense possibly damaging 0.89
R1610:Golgb1 UTSW 16 36,746,463 (GRCm39) missense probably benign 0.25
R1659:Golgb1 UTSW 16 36,707,979 (GRCm39) missense probably benign 0.01
R1769:Golgb1 UTSW 16 36,736,363 (GRCm39) missense probably damaging 1.00
R2105:Golgb1 UTSW 16 36,735,026 (GRCm39) missense probably benign
R2212:Golgb1 UTSW 16 36,707,709 (GRCm39) missense probably damaging 1.00
R2261:Golgb1 UTSW 16 36,713,722 (GRCm39) missense probably damaging 1.00
R2352:Golgb1 UTSW 16 36,718,921 (GRCm39) missense probably damaging 0.99
R2357:Golgb1 UTSW 16 36,732,370 (GRCm39) missense probably damaging 1.00
R2400:Golgb1 UTSW 16 36,738,828 (GRCm39) missense possibly damaging 0.62
R2513:Golgb1 UTSW 16 36,735,513 (GRCm39) missense possibly damaging 0.73
R3103:Golgb1 UTSW 16 36,715,211 (GRCm39) missense probably damaging 1.00
R3413:Golgb1 UTSW 16 36,707,709 (GRCm39) missense probably damaging 1.00
R3748:Golgb1 UTSW 16 36,739,274 (GRCm39) missense probably benign 0.00
R3847:Golgb1 UTSW 16 36,719,095 (GRCm39) missense probably benign 0.00
R3850:Golgb1 UTSW 16 36,719,095 (GRCm39) missense probably benign 0.00
R3936:Golgb1 UTSW 16 36,734,418 (GRCm39) nonsense probably null
R3975:Golgb1 UTSW 16 36,738,933 (GRCm39) missense probably damaging 0.99
R4025:Golgb1 UTSW 16 36,735,706 (GRCm39) missense probably benign 0.00
R4369:Golgb1 UTSW 16 36,737,269 (GRCm39) missense probably damaging 1.00
R4518:Golgb1 UTSW 16 36,749,625 (GRCm39) missense probably damaging 0.98
R4600:Golgb1 UTSW 16 36,738,987 (GRCm39) missense probably damaging 1.00
R4610:Golgb1 UTSW 16 36,738,987 (GRCm39) missense probably damaging 1.00
R4660:Golgb1 UTSW 16 36,707,980 (GRCm39) missense probably damaging 0.99
R4811:Golgb1 UTSW 16 36,711,781 (GRCm39) missense probably damaging 1.00
R4815:Golgb1 UTSW 16 36,733,477 (GRCm39) missense possibly damaging 0.79
R4835:Golgb1 UTSW 16 36,711,769 (GRCm39) missense possibly damaging 0.86
R4904:Golgb1 UTSW 16 36,713,748 (GRCm39) missense probably damaging 1.00
R4916:Golgb1 UTSW 16 36,736,480 (GRCm39) missense probably benign 0.05
R5121:Golgb1 UTSW 16 36,739,620 (GRCm39) missense probably damaging 0.99
R5133:Golgb1 UTSW 16 36,711,819 (GRCm39) missense possibly damaging 0.75
R5143:Golgb1 UTSW 16 36,719,051 (GRCm39) missense probably benign 0.09
R5185:Golgb1 UTSW 16 36,695,503 (GRCm39) unclassified probably benign
R5188:Golgb1 UTSW 16 36,738,827 (GRCm39) missense probably benign 0.13
R5260:Golgb1 UTSW 16 36,733,503 (GRCm39) missense probably benign 0.00
R5297:Golgb1 UTSW 16 36,695,978 (GRCm39) intron probably benign
R5386:Golgb1 UTSW 16 36,732,677 (GRCm39) nonsense probably null
R5438:Golgb1 UTSW 16 36,720,870 (GRCm39) missense probably benign 0.15
R5439:Golgb1 UTSW 16 36,720,870 (GRCm39) missense probably benign 0.15
R5494:Golgb1 UTSW 16 36,749,045 (GRCm39) missense possibly damaging 0.67
R5592:Golgb1 UTSW 16 36,746,125 (GRCm39) missense probably benign 0.02
R5740:Golgb1 UTSW 16 36,739,362 (GRCm39) missense probably damaging 0.99
R5862:Golgb1 UTSW 16 36,746,453 (GRCm39) splice site silent
R5928:Golgb1 UTSW 16 36,732,349 (GRCm39) missense probably damaging 1.00
R6009:Golgb1 UTSW 16 36,735,321 (GRCm39) missense probably damaging 1.00
R6062:Golgb1 UTSW 16 36,735,033 (GRCm39) missense possibly damaging 0.89
R6102:Golgb1 UTSW 16 36,733,227 (GRCm39) missense probably damaging 1.00
R6198:Golgb1 UTSW 16 36,713,757 (GRCm39) missense probably damaging 1.00
R6253:Golgb1 UTSW 16 36,735,984 (GRCm39) missense possibly damaging 0.77
R6254:Golgb1 UTSW 16 36,734,340 (GRCm39) missense probably damaging 0.99
R6321:Golgb1 UTSW 16 36,738,559 (GRCm39) nonsense probably null
R6700:Golgb1 UTSW 16 36,695,946 (GRCm39) intron probably benign
R6870:Golgb1 UTSW 16 36,738,565 (GRCm39) missense probably damaging 1.00
R6882:Golgb1 UTSW 16 36,734,352 (GRCm39) missense probably benign
R6944:Golgb1 UTSW 16 36,732,475 (GRCm39) missense probably benign
R7108:Golgb1 UTSW 16 36,734,083 (GRCm39) missense probably benign 0.01
R7124:Golgb1 UTSW 16 36,734,035 (GRCm39) missense probably benign 0.01
R7125:Golgb1 UTSW 16 36,738,325 (GRCm39) missense possibly damaging 0.85
R7187:Golgb1 UTSW 16 36,736,512 (GRCm39) missense probably benign 0.43
R7205:Golgb1 UTSW 16 36,695,663 (GRCm39) missense unknown
R7206:Golgb1 UTSW 16 36,734,111 (GRCm39) missense probably benign 0.41
R7233:Golgb1 UTSW 16 36,735,120 (GRCm39) missense possibly damaging 0.91
R7320:Golgb1 UTSW 16 36,736,313 (GRCm39) nonsense probably null
R7367:Golgb1 UTSW 16 36,718,908 (GRCm39) missense probably benign 0.00
R7408:Golgb1 UTSW 16 36,718,909 (GRCm39) missense probably damaging 0.98
R7419:Golgb1 UTSW 16 36,733,281 (GRCm39) missense possibly damaging 0.95
R7556:Golgb1 UTSW 16 36,736,155 (GRCm39) missense probably benign 0.03
R7599:Golgb1 UTSW 16 36,695,758 (GRCm39) missense unknown
R7673:Golgb1 UTSW 16 36,734,031 (GRCm39) missense probably benign 0.05
R7789:Golgb1 UTSW 16 36,695,761 (GRCm39) missense unknown
R7792:Golgb1 UTSW 16 36,739,092 (GRCm39) missense probably benign 0.43
R7830:Golgb1 UTSW 16 36,719,083 (GRCm39) missense possibly damaging 0.93
R7905:Golgb1 UTSW 16 36,734,047 (GRCm39) missense probably benign
R7944:Golgb1 UTSW 16 36,734,466 (GRCm39) missense probably benign 0.02
R7945:Golgb1 UTSW 16 36,734,466 (GRCm39) missense probably benign 0.02
R7950:Golgb1 UTSW 16 36,735,786 (GRCm39) missense probably benign 0.13
R8040:Golgb1 UTSW 16 36,733,841 (GRCm39) missense possibly damaging 0.85
R8077:Golgb1 UTSW 16 36,738,995 (GRCm39) missense probably damaging 0.99
R8181:Golgb1 UTSW 16 36,737,192 (GRCm39) missense probably damaging 1.00
R8370:Golgb1 UTSW 16 36,732,679 (GRCm39) missense probably benign 0.00
R8684:Golgb1 UTSW 16 36,734,764 (GRCm39) missense possibly damaging 0.92
R8725:Golgb1 UTSW 16 36,739,563 (GRCm39) missense probably damaging 1.00
R8727:Golgb1 UTSW 16 36,739,563 (GRCm39) missense probably damaging 1.00
R8738:Golgb1 UTSW 16 36,736,675 (GRCm39) missense probably damaging 1.00
R8785:Golgb1 UTSW 16 36,740,106 (GRCm39) missense probably damaging 0.99
R8824:Golgb1 UTSW 16 36,736,051 (GRCm39) missense probably benign
R8825:Golgb1 UTSW 16 36,739,809 (GRCm39) missense probably benign 0.00
R8940:Golgb1 UTSW 16 36,736,759 (GRCm39) missense probably damaging 1.00
R8962:Golgb1 UTSW 16 36,733,978 (GRCm39) missense probably damaging 1.00
R9245:Golgb1 UTSW 16 36,739,181 (GRCm39) nonsense probably null
R9365:Golgb1 UTSW 16 36,736,124 (GRCm39) missense probably damaging 1.00
R9612:Golgb1 UTSW 16 36,739,967 (GRCm39) missense probably benign 0.41
R9620:Golgb1 UTSW 16 36,739,811 (GRCm39) missense probably benign
R9691:Golgb1 UTSW 16 36,718,996 (GRCm39) missense probably damaging 1.00
R9747:Golgb1 UTSW 16 36,713,769 (GRCm39) missense probably damaging 1.00
V1662:Golgb1 UTSW 16 36,718,904 (GRCm39) missense probably benign 0.00
X0067:Golgb1 UTSW 16 36,734,665 (GRCm39) nonsense probably null
Z1088:Golgb1 UTSW 16 36,740,104 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGTCTCCCAGGATTGCTGG -3'
(R):5'- CCAAGCACAAGTGTTTAAGGAG -3'

Sequencing Primer
(F):5'- CTCCCAGGATTGCTGGTGAAG -3'
(R):5'- ATGTGGCAGGCTTTAAGGC -3'
Posted On 2019-12-20