Incidental Mutation 'R7847:Lipo4'
ID 606706
Institutional Source Beutler Lab
Gene Symbol Lipo4
Ensembl Gene ENSMUSG00000079344
Gene Name lipase, member O4
Synonyms Gm6857
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.099) question?
Stock # R7847 (G1)
Quality Score 225.009
Status Validated
Chromosome 19
Chromosomal Location 33498037-33517780 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 33514199 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Glutamic Acid at position 128 (V128E)
Ref Sequence ENSEMBL: ENSMUSP00000108130 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000112511]
AlphaFold F6RR30
Predicted Effect possibly damaging
Transcript: ENSMUST00000112511
AA Change: V128E

PolyPhen 2 Score 0.946 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000108130
Gene: ENSMUSG00000079344
AA Change: V128E

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:Abhydro_lipase 35 97 3e-24 PFAM
Pfam:Hydrolase_4 74 239 4.7e-8 PFAM
Pfam:Abhydrolase_1 78 214 2.5e-16 PFAM
Pfam:Abhydrolase_5 78 372 1.1e-11 PFAM
Predicted Effect
SMART Domains Protein: ENSMUSP00000121321
Gene: ENSMUSG00000079344
AA Change: V129E

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Abhydro_lipase 37 99 1.3e-24 PFAM
Pfam:Hydrolase_4 76 241 7.1e-9 PFAM
Pfam:Abhydrolase_1 80 214 8.8e-17 PFAM
Pfam:Abhydrolase_5 80 235 1.5e-8 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (45/45)
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2300002M23Rik T A 17: 35,568,652 Y296N probably benign Het
Abcc4 T C 14: 118,627,480 E378G probably damaging Het
Acp2 C T 2: 91,210,732 H422Y possibly damaging Het
Aldoart1 C T 4: 72,851,956 C205Y probably damaging Het
Alg9 T C 9: 50,789,605 L225S possibly damaging Het
Anapc1 A C 2: 128,669,908 V455G possibly damaging Het
Arhgef5 C A 6: 43,275,135 S940* probably null Het
Asb15 C A 6: 24,564,267 A240E probably damaging Het
BB014433 GCACACAGCTTTGGAGGTGTACACACCCGGGTTGGGGCCTCTACACACAGCTTTGGAGGTGTACACACCCGGGTTGGGGCCTCTGCACACAGCTTTGG GCACACAGCTTTGGAGGTGTACACACCCGGGTTGGGGCCTCTGCACACAGCTTTGG 8: 15,042,160 probably benign Het
Ccdc17 A G 4: 116,599,906 E529G probably benign Het
Cyp2b10 T C 7: 25,897,760 S26P possibly damaging Het
Dcp1b T C 6: 119,215,295 S391P probably benign Het
Dock6 A T 9: 21,801,207 L2086Q unknown Het
Ephx1 A G 1: 181,001,861 S41P probably benign Het
Erbb3 G A 10: 128,571,189 T1034M probably damaging Het
Gm17334 T A 11: 53,772,738 probably benign Het
Golgb1 A G 16: 36,931,920 H3227R probably damaging Het
Grin2c G A 11: 115,260,978 P52L possibly damaging Het
Herc2 T C 7: 56,157,560 probably null Het
Il17rb A G 14: 29,996,806 Y440H probably damaging Het
Kcng4 A G 8: 119,626,142 L343P probably damaging Het
Knl1 G A 2: 119,070,976 E1053K probably benign Het
Lmntd2 T C 7: 141,210,150 N650D probably benign Het
Lrrfip2 T C 9: 111,213,880 L460P probably damaging Het
Man2a2 G C 7: 80,368,865 A82G probably benign Het
Mtcl1 T C 17: 66,344,333 Q1379R probably damaging Het
Mtfr2 G A 10: 20,357,452 A256T probably benign Het
Mup17 T A 4: 61,593,219 H159L probably benign Het
Ndufaf1 A T 2: 119,660,053 D175E probably damaging Het
Nup210l A G 3: 90,151,123 M610V probably benign Het
Olfr1338 G T 4: 118,754,368 H59N possibly damaging Het
Olfr1354 T A 10: 78,916,896 S19T probably benign Het
Olfr955 A G 9: 39,470,505 S74P probably benign Het
Pard3b A G 1: 62,343,934 D729G probably benign Het
Phactr1 T C 13: 43,057,188 L169P possibly damaging Het
Rad54b T A 4: 11,612,655 S762R probably damaging Het
Senp5 C T 16: 31,990,173 V88I probably benign Het
Specc1l T C 10: 75,309,836 V1105A probably damaging Het
Trak2 A C 1: 58,935,818 S72A possibly damaging Het
Ttyh2 T C 11: 114,675,674 probably null Het
Ush2a G A 1: 188,430,808 C1029Y probably damaging Het
Vmn2r17 A G 5: 109,420,197 Y62C probably damaging Het
Vmn2r41 A G 7: 8,161,548 F2L probably benign Het
Xirp1 G T 9: 120,019,753 D21E possibly damaging Het
Zfp114 C A 7: 24,181,035 Q270K possibly damaging Het
Zfp341 T C 2: 154,634,194 S441P probably damaging Het
Zfp780b A C 7: 27,964,418 H237Q probably benign Het
Other mutations in Lipo4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00536:Lipo4 APN 19 33515686 missense probably damaging 1.00
IGL01609:Lipo4 APN 19 33499254 missense probably benign 0.01
IGL01731:Lipo4 APN 19 33512613 missense probably damaging 1.00
R0134:Lipo4 UTSW 19 33501606 missense probably benign 0.02
R0225:Lipo4 UTSW 19 33501606 missense probably benign 0.02
R1155:Lipo4 UTSW 19 33503195 missense probably benign
R1381:Lipo4 UTSW 19 33499341 missense probably benign 0.02
R1460:Lipo4 UTSW 19 33499318 missense probably benign
R1607:Lipo4 UTSW 19 33512673 missense probably damaging 1.00
R1777:Lipo4 UTSW 19 33499321 missense probably damaging 1.00
R1919:Lipo4 UTSW 19 33499271 missense possibly damaging 0.66
R1998:Lipo4 UTSW 19 33514301 missense probably damaging 0.98
R2088:Lipo4 UTSW 19 33500069 missense possibly damaging 0.95
R2112:Lipo4 UTSW 19 33511526 missense probably benign 0.07
R3931:Lipo4 UTSW 19 33503219 missense probably benign
R4588:Lipo4 UTSW 19 33499247 missense possibly damaging 0.82
R4869:Lipo4 UTSW 19 33501553 critical splice donor site probably null
R5406:Lipo4 UTSW 19 33503218 missense probably benign 0.00
R5640:Lipo4 UTSW 19 33501586 missense possibly damaging 0.92
R6160:Lipo4 UTSW 19 33503293 missense probably damaging 0.99
R6957:Lipo4 UTSW 19 33499367 missense probably benign 0.30
R7403:Lipo4 UTSW 19 33503279 missense possibly damaging 0.91
R7816:Lipo4 UTSW 19 33514242 missense probably damaging 1.00
R7868:Lipo4 UTSW 19 33511568 missense possibly damaging 0.68
R7890:Lipo4 UTSW 19 33501564 missense probably damaging 1.00
R7975:Lipo4 UTSW 19 33512628 missense probably damaging 1.00
R8391:Lipo4 UTSW 19 33511565 missense probably benign 0.02
R9428:Lipo4 UTSW 19 33517674 missense probably benign 0.09
X0028:Lipo4 UTSW 19 33503288 frame shift probably null
Z1176:Lipo4 UTSW 19 33503184 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGTTTTAGCAGTAACACAAAGTCCC -3'
(R):5'- CCCTGTGTGCTAGTTTCAGAATC -3'

Sequencing Primer
(F):5'- CAAACCAGGTTACTCAAGTCAGTC -3'
(R):5'- GGCTCCATCATGCATATATGAAG -3'
Posted On 2019-12-20