Mutagenetix > Incidental Mutation

Incidental Mutation 'R7848:Itga8'

606711

Institutional Source

Beutler Lab

Gene Symbol

Itga8

Ensembl Gene

ENSMUSG00000026768

Gene Name

integrin alpha 8

Synonyms

MMRRC Submission

Accession Numbers

Essential gene?

Probably essential (E-score: 0.898) question?

Stock #

R7848 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

12106632-12301922 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 12191737 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Isoleucine at position 623 (N623I)

Ref Sequence

ENSEMBL: ENSMUSP00000028106 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000028106] [ENSMUST00000172791]

AlphaFold

A2ARA8

Predicted Effect

probably damaging
Transcript: ENSMUST00000028106
AA Change: N623I

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000028106
Gene: ENSMUSG00000026768
AA Change: N623I

Domain	Start	End	E-Value	Type
signal peptide	1	37	N/A	INTRINSIC
Int_alpha	52	112	8.48e-8	SMART
Int_alpha	197	244	4.8e1	SMART
Int_alpha	262	312	5.91e-7	SMART
Int_alpha	316	377	6.94e-13	SMART
Int_alpha	381	437	1.92e-15	SMART
Int_alpha	445	494	8.23e-6	SMART
SCOP:d1m1xa2	643	780	2e-46	SMART
SCOP:d1m1xa3	784	1000	2e-80	SMART
transmembrane domain	1011	1033	N/A	INTRINSIC
Pfam:Integrin_alpha	1034	1048	2.5e-7	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000172791

SMART Domains

Protein: ENSMUSP00000134154
Gene: ENSMUSG00000026768

Domain	Start	End	E-Value	Type
signal peptide	1	37	N/A	INTRINSIC
Int_alpha	52	112	8.48e-8	SMART
Int_alpha	197	244	4.8e1	SMART
Int_alpha	262	312	5.91e-7	SMART
Int_alpha	316	377	6.94e-13	SMART
Int_alpha	381	437	1.92e-15	SMART
Int_alpha	445	494	8.23e-6	SMART

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.3%

Validation Efficiency

100% (62/62)

MGI Phenotype

FUNCTION: This gene encodes a member of the integrin family of cell surface proteins that mediate cellular interactions with the extracellular matrix and other cells. The encoded protein undergoes proteolytic processing to generate the disulfide-linked heterodimeric alpha subunit which, in turn associates with a beta subunit to form the functional integrin receptor. Mice lacking the encoded protein mostly die after birth due to kidney defects, but some of animals that survive exhibit defects in the sensory hair cells of the inner ear. [provided by RefSeq, Aug 2016]
PHENOTYPE: Mice homozygous for disruptions in this gene usually die by the end of the second day after birth. Those that do survive have reduced kidneys and abnormal steriocilia in the inner ear. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 61 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2900026A02Rik	C	T	5: 113,192,141	A2T	probably damaging	Het
Abca3	G	T	17: 24,384,532	G566V	probably damaging	Het
Aff4	C	A	11: 53,404,512	N846K	probably benign	Het
Aldh1l2	C	T	10: 83,499,843	R714Q	probably benign	Het
BC027072	T	C	17: 71,749,193	D1163G	probably benign	Het
Cbln1	T	C	8: 87,471,700	T126A	probably damaging	Het
Ccdc84	A	G	9: 44,413,642	S139P	probably damaging	Het
Ccdc85a	A	G	11: 28,396,123	S446P	possibly damaging	Het
Ccdc87	A	G	19: 4,841,508	Q676R	probably damaging	Het
Col26a1	T	C	5: 136,747,053	K349E	possibly damaging	Het
Col6a5	T	C	9: 105,928,186	I1174V	unknown	Het
Cyth1	TGGGCAA	T	11: 118,183,923		probably null	Het
Dmxl1	A	G	18: 49,840,490	D64G	possibly damaging	Het
Dnajc15	T	C	14: 77,840,203	H114R	probably damaging	Het
Espl1	T	C	15: 102,316,526	F1390S	probably damaging	Het
F5	T	C	1: 164,161,877	I116T	possibly damaging	Het
Fam120b	T	C	17: 15,405,774	V463A	possibly damaging	Het
Fat4	A	G	3: 38,887,851	M298V	probably benign	Het
Fhad1	A	T	4: 141,905,602	M1197K	probably benign	Het
Fn1	T	A	1: 71,650,601	I127F	probably damaging	Het
Frmd4a	A	G	2: 4,591,917		probably benign	Het
Gabpb2	A	T	3: 95,190,648	V238E	probably damaging	Het
Gnpat	C	A	8: 124,886,891	Q626K	possibly damaging	Het
Gstm7	A	T	3: 107,928,586		probably null	Het
Gys2	G	T	6: 142,446,015	S507*	probably null	Het
Ippk	T	A	13: 49,443,496		probably null	Het
Kcnb1	A	G	2: 167,106,268	F220S	probably damaging	Het
Kiz	T	A	2: 146,889,180	S197T	probably benign	Het
Klhl42	A	G	6: 147,108,100	N479S	probably damaging	Het
Lims2	A	G	18: 31,958,248	*60W	probably null	Het
Lrch4	A	G	5: 137,633,854	N124S	probably damaging	Het
Man2a2	G	C	7: 80,368,865	A82G	probably benign	Het
Map3k13	T	C	16: 21,905,871	V373A	probably damaging	Het
Mapkapk5	A	G	5: 121,545,169	I11T	probably benign	Het
Mroh2b	C	T	15: 4,938,379	Q967*	probably null	Het
Mthfd1l	A	G	10: 4,083,739	T709A	possibly damaging	Het
Muc6	T	C	7: 141,645,921	T939A	possibly damaging	Het
Ncam2	C	T	16: 81,490,379	H394Y	probably benign	Het
Ncoa7	A	T	10: 30,648,418	N161K	possibly damaging	Het
Nr2c1	C	T	10: 94,190,646	S461L	probably benign	Het
Nrg3	T	C	14: 38,668,283	E323G	probably damaging	Het
Nufip1	G	A	14: 76,114,221	R172H	probably damaging	Het
Nup210l	A	G	3: 90,203,905	T1705A	probably benign	Het
Oaf	G	A	9: 43,222,780	R215C	probably damaging	Het
Ogfr	T	C	2: 180,592,433	L99P	probably damaging	Het
Olfr1349	T	C	7: 6,514,862	D189G	probably damaging	Het
Olfr644	T	A	7: 104,068,095	N312I	probably benign	Het
Pcdh18	A	T	3: 49,755,997	S290T	possibly damaging	Het
Pklr	T	G	3: 89,142,978	I378S	possibly damaging	Het
Rbm12	A	T	2: 156,096,216	M712K	probably benign	Het
Rnase10	T	C	14: 51,009,513	V116A	possibly damaging	Het
Scube3	T	C	17: 28,165,595	L621P	probably benign	Het
Slc35e1	T	C	8: 72,492,436	I51V	probably benign	Het
Smcr8	A	G	11: 60,779,924	T633A	probably benign	Het
St18	T	C	1: 6,857,445		probably null	Het
Tcrg-V5	G	A	13: 19,192,679	V99I	probably damaging	Het
Tm9sf4	T	A	2: 153,202,355	I509N	probably damaging	Het
Tmcc2	T	C	1: 132,360,621	K443E	probably damaging	Het
Tmem98	T	G	11: 80,819,932	V139G	probably damaging	Het
Ttll1	T	C	15: 83,497,372	E232G	probably damaging	Het
Zfp442	T	C	2: 150,411,226	N39D	possibly damaging	Het

Other mutations in Itga8

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00806:Itga8	APN	2	12255966	nonsense	probably null
IGL00820:Itga8	APN	2	12232892	missense	possibly damaging	0.85
IGL01409:Itga8	APN	2	12191714	missense	probably benign
IGL01508:Itga8	APN	2	12232802	missense	possibly damaging	0.67
IGL01585:Itga8	APN	2	12160312	splice site	probably benign
IGL01590:Itga8	APN	2	12160333	missense	probably damaging	1.00
IGL01743:Itga8	APN	2	12265333	missense	probably benign	0.04
IGL02634:Itga8	APN	2	12140478	missense	possibly damaging	0.55
IGL02805:Itga8	APN	2	12189480	missense	possibly damaging	0.83
IGL03200:Itga8	APN	2	12191199	missense	probably benign	0.00
IGL03218:Itga8	APN	2	12111025	missense	possibly damaging	0.77
IGL03248:Itga8	APN	2	12132516	missense	probably benign	0.20
PIT4576001:Itga8	UTSW	2	12230092	missense	probably benign	0.19
R0196:Itga8	UTSW	2	12204729	critical splice donor site	probably null
R0356:Itga8	UTSW	2	12182721	missense	possibly damaging	0.73
R0466:Itga8	UTSW	2	12232886	missense	probably damaging	1.00
R0530:Itga8	UTSW	2	12191816	missense	probably damaging	0.99
R0715:Itga8	UTSW	2	12191242	splice site	probably benign
R0800:Itga8	UTSW	2	12193551	missense	possibly damaging	0.95
R0881:Itga8	UTSW	2	12262192	splice site	probably null
R1675:Itga8	UTSW	2	12200163	missense	probably damaging	0.99
R1758:Itga8	UTSW	2	12265333	missense	possibly damaging	0.83
R1939:Itga8	UTSW	2	12300846	missense	probably damaging	1.00
R2187:Itga8	UTSW	2	12194420	missense	possibly damaging	0.60
R2295:Itga8	UTSW	2	12182709	missense	probably benign	0.38
R2356:Itga8	UTSW	2	12200141	missense	probably benign
R2371:Itga8	UTSW	2	12253466	missense	probably damaging	1.00
R2412:Itga8	UTSW	2	12301715	missense	probably benign
R2440:Itga8	UTSW	2	12178680	missense	possibly damaging	0.70
R2848:Itga8	UTSW	2	12160404	missense	probably damaging	0.98
R3730:Itga8	UTSW	2	12193510	missense	possibly damaging	0.92
R3933:Itga8	UTSW	2	12189519	missense	probably benign
R3982:Itga8	UTSW	2	12300963	missense	possibly damaging	0.92
R4513:Itga8	UTSW	2	12182736	missense	probably benign	0.01
R4514:Itga8	UTSW	2	12182736	missense	probably benign	0.01
R4660:Itga8	UTSW	2	12265258	missense	probably damaging	1.00
R4890:Itga8	UTSW	2	12193291	splice site	probably benign
R5533:Itga8	UTSW	2	12160350	missense	possibly damaging	0.90
R5619:Itga8	UTSW	2	12265328	missense	probably damaging	1.00
R5720:Itga8	UTSW	2	12111087	missense	probably damaging	0.99
R5749:Itga8	UTSW	2	12262078	missense	probably damaging	1.00
R5930:Itga8	UTSW	2	12230208	missense	possibly damaging	0.84
R5954:Itga8	UTSW	2	12132486	missense	probably damaging	0.99
R6035:Itga8	UTSW	2	12191714	missense	probably benign
R6035:Itga8	UTSW	2	12191714	missense	probably benign
R6211:Itga8	UTSW	2	12193509	missense	probably damaging	1.00
R6337:Itga8	UTSW	2	12253469	nonsense	probably null
R6442:Itga8	UTSW	2	12230143	missense	probably benign	0.00
R6491:Itga8	UTSW	2	12204776	missense	probably damaging	1.00
R6543:Itga8	UTSW	2	12301644	missense	probably damaging	0.99
R6574:Itga8	UTSW	2	12230161	missense	probably benign	0.17
R6760:Itga8	UTSW	2	12301640	missense	probably damaging	1.00
R6858:Itga8	UTSW	2	12200081	missense	probably benign	0.00
R6943:Itga8	UTSW	2	12155371	critical splice donor site	probably null
R7048:Itga8	UTSW	2	12111084	missense	probably damaging	0.99
R7203:Itga8	UTSW	2	12230095	missense	possibly damaging	0.77
R7266:Itga8	UTSW	2	12232901	missense	probably damaging	1.00
R7323:Itga8	UTSW	2	12262129	missense	probably damaging	1.00
R7540:Itga8	UTSW	2	12111037	missense	possibly damaging	0.82
R7637:Itga8	UTSW	2	12109187	missense	probably damaging	1.00
R7748:Itga8	UTSW	2	12230239	missense	possibly damaging	0.80
R8031:Itga8	UTSW	2	12155486	missense	probably benign
R8077:Itga8	UTSW	2	12242433	missense	probably benign	0.09
R8757:Itga8	UTSW	2	12262129	missense	probably damaging	1.00
R8759:Itga8	UTSW	2	12262129	missense	probably damaging	1.00
R8772:Itga8	UTSW	2	12182684	missense	probably damaging	1.00
R8773:Itga8	UTSW	2	12182684	missense	probably damaging	1.00
R8774:Itga8	UTSW	2	12182684	missense	probably damaging	1.00
R8774-TAIL:Itga8	UTSW	2	12182684	missense	probably damaging	1.00
R8775:Itga8	UTSW	2	12182684	missense	probably damaging	1.00
R8775-TAIL:Itga8	UTSW	2	12182684	missense	probably damaging	1.00
R8808:Itga8	UTSW	2	12132517	nonsense	probably null
R8898:Itga8	UTSW	2	12140395	missense	probably benign	0.05
R8962:Itga8	UTSW	2	12191234	missense	possibly damaging	0.94
R9056:Itga8	UTSW	2	12230208	missense	possibly damaging	0.84
R9155:Itga8	UTSW	2	12189519	missense	probably benign
R9354:Itga8	UTSW	2	12232857	missense	possibly damaging	0.94
R9563:Itga8	UTSW	2	12160408	missense	possibly damaging	0.83
R9589:Itga8	UTSW	2	12232890	missense	probably damaging	1.00
R9663:Itga8	UTSW	2	12191769	missense	probably benign	0.00
Z1176:Itga8	UTSW	2	12247518	missense	probably damaging	1.00
Z1176:Itga8	UTSW	2	12262136	missense	probably benign	0.01
Z1176:Itga8	UTSW	2	12301832	start gained	probably benign
Z1177:Itga8	UTSW	2	12300933	missense	possibly damaging	0.89

Predicted Primers

PCR Primer
(F):5'- GGAAACATGCTAGGATCATGCC -3'
(R):5'- GTTGAACATTGTCCTTCACTACCAC -3'

Sequencing Primer
(F):5'- ATGCTAGGATCATGCCCCTAATG -3'
(R):5'- TACCACTGACAGGAGTCCAGG -3'

Posted On

2019-12-20