Incidental Mutation 'R7848:Itga8'
ID 606711
Institutional Source Beutler Lab
Gene Symbol Itga8
Ensembl Gene ENSMUSG00000026768
Gene Name integrin alpha 8
Synonyms
MMRRC Submission 045902-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.870) question?
Stock # R7848 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 12111443-12306733 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 12196548 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Isoleucine at position 623 (N623I)
Ref Sequence ENSEMBL: ENSMUSP00000028106 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028106] [ENSMUST00000172791]
AlphaFold A2ARA8
Predicted Effect probably damaging
Transcript: ENSMUST00000028106
AA Change: N623I

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000028106
Gene: ENSMUSG00000026768
AA Change: N623I

DomainStartEndE-ValueType
signal peptide 1 37 N/A INTRINSIC
Int_alpha 52 112 8.48e-8 SMART
Int_alpha 197 244 4.8e1 SMART
Int_alpha 262 312 5.91e-7 SMART
Int_alpha 316 377 6.94e-13 SMART
Int_alpha 381 437 1.92e-15 SMART
Int_alpha 445 494 8.23e-6 SMART
SCOP:d1m1xa2 643 780 2e-46 SMART
SCOP:d1m1xa3 784 1000 2e-80 SMART
transmembrane domain 1011 1033 N/A INTRINSIC
Pfam:Integrin_alpha 1034 1048 2.5e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000172791
SMART Domains Protein: ENSMUSP00000134154
Gene: ENSMUSG00000026768

DomainStartEndE-ValueType
signal peptide 1 37 N/A INTRINSIC
Int_alpha 52 112 8.48e-8 SMART
Int_alpha 197 244 4.8e1 SMART
Int_alpha 262 312 5.91e-7 SMART
Int_alpha 316 377 6.94e-13 SMART
Int_alpha 381 437 1.92e-15 SMART
Int_alpha 445 494 8.23e-6 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 100% (62/62)
MGI Phenotype FUNCTION: This gene encodes a member of the integrin family of cell surface proteins that mediate cellular interactions with the extracellular matrix and other cells. The encoded protein undergoes proteolytic processing to generate the disulfide-linked heterodimeric alpha subunit which, in turn associates with a beta subunit to form the functional integrin receptor. Mice lacking the encoded protein mostly die after birth due to kidney defects, but some of animals that survive exhibit defects in the sensory hair cells of the inner ear. [provided by RefSeq, Aug 2016]
PHENOTYPE: Mice homozygous for disruptions in this gene usually die by the end of the second day after birth. Those that do survive have reduced kidneys and abnormal steriocilia in the inner ear. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900026A02Rik C T 5: 113,340,007 (GRCm39) A2T probably damaging Het
Abca3 G T 17: 24,603,506 (GRCm39) G566V probably damaging Het
Aff4 C A 11: 53,295,339 (GRCm39) N846K probably benign Het
Aldh1l2 C T 10: 83,335,707 (GRCm39) R714Q probably benign Het
Cbln1 T C 8: 88,198,328 (GRCm39) T126A probably damaging Het
Ccdc85a A G 11: 28,346,123 (GRCm39) S446P possibly damaging Het
Ccdc87 A G 19: 4,891,536 (GRCm39) Q676R probably damaging Het
Cenatac A G 9: 44,324,939 (GRCm39) S139P probably damaging Het
Col26a1 T C 5: 136,775,907 (GRCm39) K349E possibly damaging Het
Col6a5 T C 9: 105,805,385 (GRCm39) I1174V unknown Het
Cyth1 TGGGCAA T 11: 118,074,749 (GRCm39) probably null Het
Dmxl1 A G 18: 49,973,557 (GRCm39) D64G possibly damaging Het
Dnajc15 T C 14: 78,077,643 (GRCm39) H114R probably damaging Het
Espl1 T C 15: 102,224,961 (GRCm39) F1390S probably damaging Het
F5 T C 1: 163,989,446 (GRCm39) I116T possibly damaging Het
Fam120b T C 17: 15,626,036 (GRCm39) V463A possibly damaging Het
Fat4 A G 3: 38,942,000 (GRCm39) M298V probably benign Het
Fhad1 A T 4: 141,632,913 (GRCm39) M1197K probably benign Het
Fn1 T A 1: 71,689,760 (GRCm39) I127F probably damaging Het
Frmd4a A G 2: 4,596,728 (GRCm39) probably benign Het
Gabpb2 A T 3: 95,097,959 (GRCm39) V238E probably damaging Het
Gnpat C A 8: 125,613,630 (GRCm39) Q626K possibly damaging Het
Gstm7 A T 3: 107,835,902 (GRCm39) probably null Het
Gys2 G T 6: 142,391,741 (GRCm39) S507* probably null Het
Ippk T A 13: 49,596,972 (GRCm39) probably null Het
Kcnb1 A G 2: 166,948,188 (GRCm39) F220S probably damaging Het
Kiz T A 2: 146,731,100 (GRCm39) S197T probably benign Het
Klhl42 A G 6: 147,009,598 (GRCm39) N479S probably damaging Het
Lims2 A G 18: 32,091,301 (GRCm39) *60W probably null Het
Lrch4 A G 5: 137,632,116 (GRCm39) N124S probably damaging Het
Man2a2 G C 7: 80,018,613 (GRCm39) A82G probably benign Het
Map3k13 T C 16: 21,724,621 (GRCm39) V373A probably damaging Het
Mapkapk5 A G 5: 121,683,232 (GRCm39) I11T probably benign Het
Mroh2b C T 15: 4,967,861 (GRCm39) Q967* probably null Het
Mthfd1l A G 10: 4,033,739 (GRCm39) T709A possibly damaging Het
Muc6 T C 7: 141,232,188 (GRCm39) T939A possibly damaging Het
Ncam2 C T 16: 81,287,267 (GRCm39) H394Y probably benign Het
Ncoa7 A T 10: 30,524,414 (GRCm39) N161K possibly damaging Het
Nr2c1 C T 10: 94,026,508 (GRCm39) S461L probably benign Het
Nrg3 T C 14: 38,390,240 (GRCm39) E323G probably damaging Het
Nufip1 G A 14: 76,351,661 (GRCm39) R172H probably damaging Het
Nup210l A G 3: 90,111,212 (GRCm39) T1705A probably benign Het
Oaf G A 9: 43,134,077 (GRCm39) R215C probably damaging Het
Ogfr T C 2: 180,234,226 (GRCm39) L99P probably damaging Het
Or10am5 T C 7: 6,517,861 (GRCm39) D189G probably damaging Het
Or51a43 T A 7: 103,717,302 (GRCm39) N312I probably benign Het
Pcare T C 17: 72,056,188 (GRCm39) D1163G probably benign Het
Pcdh18 A T 3: 49,710,446 (GRCm39) S290T possibly damaging Het
Pklr T G 3: 89,050,285 (GRCm39) I378S possibly damaging Het
Rbm12 A T 2: 155,938,136 (GRCm39) M712K probably benign Het
Rnase10 T C 14: 51,246,970 (GRCm39) V116A possibly damaging Het
Scube3 T C 17: 28,384,569 (GRCm39) L621P probably benign Het
Slc35e1 T C 8: 73,246,280 (GRCm39) I51V probably benign Het
Smcr8 A G 11: 60,670,750 (GRCm39) T633A probably benign Het
St18 T C 1: 6,927,669 (GRCm39) probably null Het
Tm9sf4 T A 2: 153,044,275 (GRCm39) I509N probably damaging Het
Tmcc2 T C 1: 132,288,359 (GRCm39) K443E probably damaging Het
Tmem98 T G 11: 80,710,758 (GRCm39) V139G probably damaging Het
Trgv5 G A 13: 19,376,849 (GRCm39) V99I probably damaging Het
Ttll1 T C 15: 83,381,573 (GRCm39) E232G probably damaging Het
Zfp442 T C 2: 150,253,146 (GRCm39) N39D possibly damaging Het
Other mutations in Itga8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00806:Itga8 APN 2 12,260,777 (GRCm39) nonsense probably null
IGL00820:Itga8 APN 2 12,237,703 (GRCm39) missense possibly damaging 0.85
IGL01409:Itga8 APN 2 12,196,525 (GRCm39) missense probably benign
IGL01508:Itga8 APN 2 12,237,613 (GRCm39) missense possibly damaging 0.67
IGL01585:Itga8 APN 2 12,165,123 (GRCm39) splice site probably benign
IGL01590:Itga8 APN 2 12,165,144 (GRCm39) missense probably damaging 1.00
IGL01743:Itga8 APN 2 12,270,144 (GRCm39) missense probably benign 0.04
IGL02634:Itga8 APN 2 12,145,289 (GRCm39) missense possibly damaging 0.55
IGL02805:Itga8 APN 2 12,194,291 (GRCm39) missense possibly damaging 0.83
IGL03200:Itga8 APN 2 12,196,010 (GRCm39) missense probably benign 0.00
IGL03218:Itga8 APN 2 12,115,836 (GRCm39) missense possibly damaging 0.77
IGL03248:Itga8 APN 2 12,137,327 (GRCm39) missense probably benign 0.20
PIT4576001:Itga8 UTSW 2 12,234,903 (GRCm39) missense probably benign 0.19
R0196:Itga8 UTSW 2 12,209,540 (GRCm39) critical splice donor site probably null
R0356:Itga8 UTSW 2 12,187,532 (GRCm39) missense possibly damaging 0.73
R0466:Itga8 UTSW 2 12,237,697 (GRCm39) missense probably damaging 1.00
R0530:Itga8 UTSW 2 12,196,627 (GRCm39) missense probably damaging 0.99
R0715:Itga8 UTSW 2 12,196,053 (GRCm39) splice site probably benign
R0800:Itga8 UTSW 2 12,198,362 (GRCm39) missense possibly damaging 0.95
R0881:Itga8 UTSW 2 12,267,003 (GRCm39) splice site probably null
R1675:Itga8 UTSW 2 12,204,974 (GRCm39) missense probably damaging 0.99
R1758:Itga8 UTSW 2 12,270,144 (GRCm39) missense possibly damaging 0.83
R1939:Itga8 UTSW 2 12,305,657 (GRCm39) missense probably damaging 1.00
R2187:Itga8 UTSW 2 12,199,231 (GRCm39) missense possibly damaging 0.60
R2295:Itga8 UTSW 2 12,187,520 (GRCm39) missense probably benign 0.38
R2356:Itga8 UTSW 2 12,204,952 (GRCm39) missense probably benign
R2371:Itga8 UTSW 2 12,258,277 (GRCm39) missense probably damaging 1.00
R2412:Itga8 UTSW 2 12,306,526 (GRCm39) missense probably benign
R2440:Itga8 UTSW 2 12,183,491 (GRCm39) missense possibly damaging 0.70
R2848:Itga8 UTSW 2 12,165,215 (GRCm39) missense probably damaging 0.98
R3730:Itga8 UTSW 2 12,198,321 (GRCm39) missense possibly damaging 0.92
R3933:Itga8 UTSW 2 12,194,330 (GRCm39) missense probably benign
R3982:Itga8 UTSW 2 12,305,774 (GRCm39) missense possibly damaging 0.92
R4513:Itga8 UTSW 2 12,187,547 (GRCm39) missense probably benign 0.01
R4514:Itga8 UTSW 2 12,187,547 (GRCm39) missense probably benign 0.01
R4660:Itga8 UTSW 2 12,270,069 (GRCm39) missense probably damaging 1.00
R4890:Itga8 UTSW 2 12,198,102 (GRCm39) splice site probably benign
R5533:Itga8 UTSW 2 12,165,161 (GRCm39) missense possibly damaging 0.90
R5619:Itga8 UTSW 2 12,270,139 (GRCm39) missense probably damaging 1.00
R5720:Itga8 UTSW 2 12,115,898 (GRCm39) missense probably damaging 0.99
R5749:Itga8 UTSW 2 12,266,889 (GRCm39) missense probably damaging 1.00
R5930:Itga8 UTSW 2 12,235,019 (GRCm39) missense possibly damaging 0.84
R5954:Itga8 UTSW 2 12,137,297 (GRCm39) missense probably damaging 0.99
R6035:Itga8 UTSW 2 12,196,525 (GRCm39) missense probably benign
R6035:Itga8 UTSW 2 12,196,525 (GRCm39) missense probably benign
R6211:Itga8 UTSW 2 12,198,320 (GRCm39) missense probably damaging 1.00
R6337:Itga8 UTSW 2 12,258,280 (GRCm39) nonsense probably null
R6442:Itga8 UTSW 2 12,234,954 (GRCm39) missense probably benign 0.00
R6491:Itga8 UTSW 2 12,209,587 (GRCm39) missense probably damaging 1.00
R6543:Itga8 UTSW 2 12,306,455 (GRCm39) missense probably damaging 0.99
R6574:Itga8 UTSW 2 12,234,972 (GRCm39) missense probably benign 0.17
R6760:Itga8 UTSW 2 12,306,451 (GRCm39) missense probably damaging 1.00
R6858:Itga8 UTSW 2 12,204,892 (GRCm39) missense probably benign 0.00
R6943:Itga8 UTSW 2 12,160,182 (GRCm39) critical splice donor site probably null
R7048:Itga8 UTSW 2 12,115,895 (GRCm39) missense probably damaging 0.99
R7203:Itga8 UTSW 2 12,234,906 (GRCm39) missense possibly damaging 0.77
R7266:Itga8 UTSW 2 12,237,712 (GRCm39) missense probably damaging 1.00
R7323:Itga8 UTSW 2 12,266,940 (GRCm39) missense probably damaging 1.00
R7540:Itga8 UTSW 2 12,115,848 (GRCm39) missense possibly damaging 0.82
R7637:Itga8 UTSW 2 12,113,998 (GRCm39) missense probably damaging 1.00
R7748:Itga8 UTSW 2 12,235,050 (GRCm39) missense possibly damaging 0.80
R8031:Itga8 UTSW 2 12,160,297 (GRCm39) missense probably benign
R8077:Itga8 UTSW 2 12,247,244 (GRCm39) missense probably benign 0.09
R8757:Itga8 UTSW 2 12,266,940 (GRCm39) missense probably damaging 1.00
R8759:Itga8 UTSW 2 12,266,940 (GRCm39) missense probably damaging 1.00
R8772:Itga8 UTSW 2 12,187,495 (GRCm39) missense probably damaging 1.00
R8773:Itga8 UTSW 2 12,187,495 (GRCm39) missense probably damaging 1.00
R8774:Itga8 UTSW 2 12,187,495 (GRCm39) missense probably damaging 1.00
R8774-TAIL:Itga8 UTSW 2 12,187,495 (GRCm39) missense probably damaging 1.00
R8775:Itga8 UTSW 2 12,187,495 (GRCm39) missense probably damaging 1.00
R8775-TAIL:Itga8 UTSW 2 12,187,495 (GRCm39) missense probably damaging 1.00
R8808:Itga8 UTSW 2 12,137,328 (GRCm39) nonsense probably null
R8898:Itga8 UTSW 2 12,145,206 (GRCm39) missense probably benign 0.05
R8962:Itga8 UTSW 2 12,196,045 (GRCm39) missense possibly damaging 0.94
R9056:Itga8 UTSW 2 12,235,019 (GRCm39) missense possibly damaging 0.84
R9155:Itga8 UTSW 2 12,194,330 (GRCm39) missense probably benign
R9354:Itga8 UTSW 2 12,237,668 (GRCm39) missense possibly damaging 0.94
R9563:Itga8 UTSW 2 12,165,219 (GRCm39) missense possibly damaging 0.83
R9589:Itga8 UTSW 2 12,237,701 (GRCm39) missense probably damaging 1.00
R9663:Itga8 UTSW 2 12,196,580 (GRCm39) missense probably benign 0.00
Z1176:Itga8 UTSW 2 12,306,643 (GRCm39) start gained probably benign
Z1176:Itga8 UTSW 2 12,266,947 (GRCm39) missense probably benign 0.01
Z1176:Itga8 UTSW 2 12,252,329 (GRCm39) missense probably damaging 1.00
Z1177:Itga8 UTSW 2 12,305,744 (GRCm39) missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- GGAAACATGCTAGGATCATGCC -3'
(R):5'- GTTGAACATTGTCCTTCACTACCAC -3'

Sequencing Primer
(F):5'- ATGCTAGGATCATGCCCCTAATG -3'
(R):5'- TACCACTGACAGGAGTCCAGG -3'
Posted On 2019-12-20