Incidental Mutation 'R7848:Ogfr'
ID606717
Institutional Source Beutler Lab
Gene Symbol Ogfr
Ensembl Gene ENSMUSG00000049401
Gene Nameopioid growth factor receptor
Synonyms2010013E17Rik
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.520) question?
Stock #R7848 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location180589245-180595836 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 180592433 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 99 (L99P)
Ref Sequence ENSEMBL: ENSMUSP00000029087 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029087]
Predicted Effect probably damaging
Transcript: ENSMUST00000029087
AA Change: L99P

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000029087
Gene: ENSMUSG00000049401
AA Change: L99P

DomainStartEndE-ValueType
low complexity region 7 40 N/A INTRINSIC
Pfam:OGFr_N 76 283 2.3e-111 PFAM
low complexity region 358 369 N/A INTRINSIC
internal_repeat_1 459 483 4.08e-5 PROSPERO
internal_repeat_1 576 600 4.08e-5 PROSPERO
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 100% (62/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a receptor for opioid growth factor (OGF), also known as [Met(5)]-enkephalin. OGF is a negative regulator of cell proliferation and tissue organization in a variety of processes. The encoded unbound receptor for OGF has been localized to the outer nuclear envelope, where it binds OGF and is translocated into the nucleus. The coding sequence of this gene contains a polymorphic region of 60 nt tandem imperfect repeat units. Several transcripts containing between zero and eight repeat units have been reported. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900026A02Rik C T 5: 113,192,141 A2T probably damaging Het
Abca3 G T 17: 24,384,532 G566V probably damaging Het
Aff4 C A 11: 53,404,512 N846K probably benign Het
Aldh1l2 C T 10: 83,499,843 R714Q probably benign Het
BC027072 T C 17: 71,749,193 D1163G probably benign Het
Cbln1 T C 8: 87,471,700 T126A probably damaging Het
Ccdc84 A G 9: 44,413,642 S139P probably damaging Het
Ccdc85a A G 11: 28,396,123 S446P possibly damaging Het
Ccdc87 A G 19: 4,841,508 Q676R probably damaging Het
Col26a1 T C 5: 136,747,053 K349E possibly damaging Het
Col6a5 T C 9: 105,928,186 I1174V unknown Het
Cyth1 TGGGCAA T 11: 118,183,923 probably null Het
Dmxl1 A G 18: 49,840,490 D64G possibly damaging Het
Dnajc15 T C 14: 77,840,203 H114R probably damaging Het
Espl1 T C 15: 102,316,526 F1390S probably damaging Het
F5 T C 1: 164,161,877 I116T possibly damaging Het
Fam120b T C 17: 15,405,774 V463A possibly damaging Het
Fat4 A G 3: 38,887,851 M298V probably benign Het
Fhad1 A T 4: 141,905,602 M1197K probably benign Het
Fn1 T A 1: 71,650,601 I127F probably damaging Het
Frmd4a A G 2: 4,591,917 probably benign Het
Gabpb2 A T 3: 95,190,648 V238E probably damaging Het
Gnpat C A 8: 124,886,891 Q626K possibly damaging Het
Gstm7 A T 3: 107,928,586 probably null Het
Gys2 G T 6: 142,446,015 S507* probably null Het
Ippk T A 13: 49,443,496 probably null Het
Itga8 T A 2: 12,191,737 N623I probably damaging Het
Kcnb1 A G 2: 167,106,268 F220S probably damaging Het
Kiz T A 2: 146,889,180 S197T probably benign Het
Klhl42 A G 6: 147,108,100 N479S probably damaging Het
Lims2 A G 18: 31,958,248 *60W probably null Het
Lrch4 A G 5: 137,633,854 N124S probably damaging Het
Man2a2 G C 7: 80,368,865 A82G probably benign Het
Map3k13 T C 16: 21,905,871 V373A probably damaging Het
Mapkapk5 A G 5: 121,545,169 I11T probably benign Het
Mroh2b C T 15: 4,938,379 Q967* probably null Het
Mthfd1l A G 10: 4,083,739 T709A possibly damaging Het
Muc6 T C 7: 141,645,921 T939A possibly damaging Het
Ncam2 C T 16: 81,490,379 H394Y probably benign Het
Ncoa7 A T 10: 30,648,418 N161K possibly damaging Het
Nr2c1 C T 10: 94,190,646 S461L probably benign Het
Nrg3 T C 14: 38,668,283 E323G probably damaging Het
Nufip1 G A 14: 76,114,221 R172H probably damaging Het
Nup210l A G 3: 90,203,905 T1705A probably benign Het
Oaf G A 9: 43,222,780 R215C probably damaging Het
Olfr1349 T C 7: 6,514,862 D189G probably damaging Het
Olfr644 T A 7: 104,068,095 N312I probably benign Het
Pcdh18 A T 3: 49,755,997 S290T possibly damaging Het
Pklr T G 3: 89,142,978 I378S possibly damaging Het
Rbm12 A T 2: 156,096,216 M712K probably benign Het
Rnase10 T C 14: 51,009,513 V116A possibly damaging Het
Scube3 T C 17: 28,165,595 L621P probably benign Het
Slc35e1 T C 8: 72,492,436 I51V probably benign Het
Smcr8 A G 11: 60,779,924 T633A probably benign Het
St18 T C 1: 6,857,445 probably null Het
Tcrg-V5 G A 13: 19,192,679 V99I probably damaging Het
Tm9sf4 T A 2: 153,202,355 I509N probably damaging Het
Tmcc2 T C 1: 132,360,621 K443E probably damaging Het
Tmem98 T G 11: 80,819,932 V139G probably damaging Het
Ttll1 T C 15: 83,497,372 E232G probably damaging Het
Zfp442 T C 2: 150,411,226 N39D possibly damaging Het
Other mutations in Ogfr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00480:Ogfr APN 2 180593562 unclassified probably benign
IGL02437:Ogfr APN 2 180589536 missense possibly damaging 0.72
IGL02602:Ogfr APN 2 180595437 missense possibly damaging 0.85
IGL02609:Ogfr APN 2 180592515 splice site probably benign
IGL03297:Ogfr APN 2 180594407 missense possibly damaging 0.93
BB017:Ogfr UTSW 2 180595266 unclassified probably benign
PIT4812001:Ogfr UTSW 2 180595511 missense possibly damaging 0.93
R0085:Ogfr UTSW 2 180591037 synonymous probably null
R0398:Ogfr UTSW 2 180593699 missense probably damaging 0.99
R1313:Ogfr UTSW 2 180594630 missense probably benign
R1313:Ogfr UTSW 2 180594630 missense probably benign
R1468:Ogfr UTSW 2 180594750 missense probably damaging 1.00
R1468:Ogfr UTSW 2 180594750 missense probably damaging 1.00
R4747:Ogfr UTSW 2 180594423 missense probably damaging 0.99
R4902:Ogfr UTSW 2 180593725 unclassified probably benign
R5422:Ogfr UTSW 2 180595274 missense possibly damaging 0.63
R5422:Ogfr UTSW 2 180595275 missense probably benign 0.02
R5860:Ogfr UTSW 2 180592492 missense probably damaging 1.00
R5988:Ogfr UTSW 2 180594233 missense probably damaging 1.00
R6015:Ogfr UTSW 2 180594674 missense probably damaging 1.00
R6558:Ogfr UTSW 2 180595404 missense possibly damaging 0.93
R6721:Ogfr UTSW 2 180595428 missense possibly damaging 0.70
R7111:Ogfr UTSW 2 180595266 unclassified probably benign
R7201:Ogfr UTSW 2 180595094 unclassified probably benign
R7217:Ogfr UTSW 2 180595266 unclassified probably benign
R7243:Ogfr UTSW 2 180595266 unclassified probably benign
R7387:Ogfr UTSW 2 180595266 unclassified probably benign
R7563:Ogfr UTSW 2 180592507 critical splice donor site probably null
R7681:Ogfr UTSW 2 180595266 unclassified probably benign
R7844:Ogfr UTSW 2 180595057 unclassified probably benign
R7845:Ogfr UTSW 2 180595266 unclassified probably benign
R7930:Ogfr UTSW 2 180595266 unclassified probably benign
R8011:Ogfr UTSW 2 180595266 unclassified probably benign
R8039:Ogfr UTSW 2 180595266 unclassified probably benign
R8045:Ogfr UTSW 2 180595057 unclassified probably benign
R8094:Ogfr UTSW 2 180595266 unclassified probably benign
RF022:Ogfr UTSW 2 180595266 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- CCAGAGAGGAATTATTGCACCC -3'
(R):5'- TCCCAGGACATAAAAGCCTG -3'

Sequencing Primer
(F):5'- GAGAGGAATTATTGCACCCCTTAC -3'
(R):5'- TGCCCACAGACCTGAGC -3'
Posted On2019-12-20