Incidental Mutation 'R7848:Pcdh18'
ID606719
Institutional Source Beutler Lab
Gene Symbol Pcdh18
Ensembl Gene ENSMUSG00000037892
Gene Nameprotocadherin 18
SynonymsPCDH68L
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7848 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location49743296-49757325 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 49755997 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 290 (S290T)
Ref Sequence ENSEMBL: ENSMUSP00000039245 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035931] [ENSMUST00000191794]
Predicted Effect possibly damaging
Transcript: ENSMUST00000035931
AA Change: S290T

PolyPhen 2 Score 0.536 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000039245
Gene: ENSMUSG00000037892
AA Change: S290T

DomainStartEndE-ValueType
low complexity region 12 21 N/A INTRINSIC
CA 51 135 1.36e-1 SMART
CA 159 244 3.78e-20 SMART
CA 268 352 1.12e-22 SMART
CA 382 463 5.76e-25 SMART
CA 487 574 2.51e-25 SMART
CA 603 684 8e-3 SMART
transmembrane domain 698 720 N/A INTRINSIC
low complexity region 772 783 N/A INTRINSIC
low complexity region 988 1009 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000191794
AA Change: S290T

PolyPhen 2 Score 0.536 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000141995
Gene: ENSMUSG00000037892
AA Change: S290T

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
CA 51 135 6.6e-4 SMART
CA 159 244 1.9e-22 SMART
CA 268 352 5.6e-25 SMART
CA 382 463 2.7e-27 SMART
CA 487 574 1.2e-27 SMART
CA 603 684 3.9e-5 SMART
transmembrane domain 698 720 N/A INTRINSIC
low complexity region 772 783 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000194603
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 100% (62/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the protocadherin gene family, a subfamily of the cadherin superfamily. This gene encodes a protein which contains 6 extracellular cadherin domains, a transmembrane domain and a cytoplasmic tail differing from those of the classical cadherins. Although its specific function is undetermined, the cadherin-related neuronal receptor is thought to play a role in the establishment and function of specific cell-cell connections in the brain. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900026A02Rik C T 5: 113,192,141 A2T probably damaging Het
Abca3 G T 17: 24,384,532 G566V probably damaging Het
Aff4 C A 11: 53,404,512 N846K probably benign Het
Aldh1l2 C T 10: 83,499,843 R714Q probably benign Het
BC027072 T C 17: 71,749,193 D1163G probably benign Het
Cbln1 T C 8: 87,471,700 T126A probably damaging Het
Ccdc84 A G 9: 44,413,642 S139P probably damaging Het
Ccdc85a A G 11: 28,396,123 S446P possibly damaging Het
Ccdc87 A G 19: 4,841,508 Q676R probably damaging Het
Col26a1 T C 5: 136,747,053 K349E possibly damaging Het
Col6a5 T C 9: 105,928,186 I1174V unknown Het
Cyth1 TGGGCAA T 11: 118,183,923 probably null Het
Dmxl1 A G 18: 49,840,490 D64G possibly damaging Het
Dnajc15 T C 14: 77,840,203 H114R probably damaging Het
Espl1 T C 15: 102,316,526 F1390S probably damaging Het
F5 T C 1: 164,161,877 I116T possibly damaging Het
Fam120b T C 17: 15,405,774 V463A possibly damaging Het
Fat4 A G 3: 38,887,851 M298V probably benign Het
Fhad1 A T 4: 141,905,602 M1197K probably benign Het
Fn1 T A 1: 71,650,601 I127F probably damaging Het
Frmd4a A G 2: 4,591,917 probably benign Het
Gabpb2 A T 3: 95,190,648 V238E probably damaging Het
Gnpat C A 8: 124,886,891 Q626K possibly damaging Het
Gstm7 A T 3: 107,928,586 probably null Het
Gys2 G T 6: 142,446,015 S507* probably null Het
Ippk T A 13: 49,443,496 probably null Het
Itga8 T A 2: 12,191,737 N623I probably damaging Het
Kcnb1 A G 2: 167,106,268 F220S probably damaging Het
Kiz T A 2: 146,889,180 S197T probably benign Het
Klhl42 A G 6: 147,108,100 N479S probably damaging Het
Lims2 A G 18: 31,958,248 *60W probably null Het
Lrch4 A G 5: 137,633,854 N124S probably damaging Het
Man2a2 G C 7: 80,368,865 A82G probably benign Het
Map3k13 T C 16: 21,905,871 V373A probably damaging Het
Mapkapk5 A G 5: 121,545,169 I11T probably benign Het
Mroh2b C T 15: 4,938,379 Q967* probably null Het
Mthfd1l A G 10: 4,083,739 T709A possibly damaging Het
Muc6 T C 7: 141,645,921 T939A possibly damaging Het
Ncam2 C T 16: 81,490,379 H394Y probably benign Het
Ncoa7 A T 10: 30,648,418 N161K possibly damaging Het
Nr2c1 C T 10: 94,190,646 S461L probably benign Het
Nrg3 T C 14: 38,668,283 E323G probably damaging Het
Nufip1 G A 14: 76,114,221 R172H probably damaging Het
Nup210l A G 3: 90,203,905 T1705A probably benign Het
Oaf G A 9: 43,222,780 R215C probably damaging Het
Ogfr T C 2: 180,592,433 L99P probably damaging Het
Olfr1349 T C 7: 6,514,862 D189G probably damaging Het
Olfr644 T A 7: 104,068,095 N312I probably benign Het
Pklr T G 3: 89,142,978 I378S possibly damaging Het
Rbm12 A T 2: 156,096,216 M712K probably benign Het
Rnase10 T C 14: 51,009,513 V116A possibly damaging Het
Scube3 T C 17: 28,165,595 L621P probably benign Het
Slc35e1 T C 8: 72,492,436 I51V probably benign Het
Smcr8 A G 11: 60,779,924 T633A probably benign Het
St18 T C 1: 6,857,445 probably null Het
Tcrg-V5 G A 13: 19,192,679 V99I probably damaging Het
Tm9sf4 T A 2: 153,202,355 I509N probably damaging Het
Tmcc2 T C 1: 132,360,621 K443E probably damaging Het
Tmem98 T G 11: 80,819,932 V139G probably damaging Het
Ttll1 T C 15: 83,497,372 E232G probably damaging Het
Zfp442 T C 2: 150,411,226 N39D possibly damaging Het
Other mutations in Pcdh18
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00543:Pcdh18 APN 3 49753379 missense probably damaging 1.00
IGL00639:Pcdh18 APN 3 49755616 missense probably benign 0.34
IGL00954:Pcdh18 APN 3 49756389 missense probably damaging 1.00
IGL01338:Pcdh18 APN 3 49756141 missense probably damaging 1.00
IGL01339:Pcdh18 APN 3 49755798 missense probably benign 0.35
IGL01687:Pcdh18 APN 3 49753533 splice site probably benign
IGL01727:Pcdh18 APN 3 49755700 missense probably damaging 0.99
IGL01788:Pcdh18 APN 3 49755922 nonsense probably null
IGL01824:Pcdh18 APN 3 49754774 missense probably damaging 1.00
IGL01834:Pcdh18 APN 3 49756830 missense probably benign 0.03
IGL01913:Pcdh18 APN 3 49755249 missense possibly damaging 0.94
IGL01915:Pcdh18 APN 3 49744921 missense probably benign
IGL02095:Pcdh18 APN 3 49756156 missense probably benign 0.01
IGL02128:Pcdh18 APN 3 49756686 missense possibly damaging 0.65
IGL02302:Pcdh18 APN 3 49755938 missense probably benign
IGL02342:Pcdh18 APN 3 49756044 missense probably damaging 1.00
IGL02440:Pcdh18 APN 3 49744603 utr 3 prime probably benign
IGL02499:Pcdh18 APN 3 49753447 missense probably benign 0.15
IGL02570:Pcdh18 APN 3 49756625 missense probably benign 0.02
IGL02745:Pcdh18 APN 3 49755891 missense probably damaging 1.00
IGL03073:Pcdh18 APN 3 49753367 missense possibly damaging 0.93
PIT4469001:Pcdh18 UTSW 3 49755069 missense probably benign
R0078:Pcdh18 UTSW 3 49756344 missense probably damaging 1.00
R0196:Pcdh18 UTSW 3 49756698 unclassified probably null
R0524:Pcdh18 UTSW 3 49755642 missense probably damaging 0.98
R0661:Pcdh18 UTSW 3 49753318 missense possibly damaging 0.64
R0900:Pcdh18 UTSW 3 49756803 missense probably benign 0.25
R1101:Pcdh18 UTSW 3 49753379 missense probably damaging 1.00
R1463:Pcdh18 UTSW 3 49755405 missense probably damaging 0.99
R1778:Pcdh18 UTSW 3 49755634 missense probably benign 0.19
R1850:Pcdh18 UTSW 3 49756405 missense probably benign 0.22
R1875:Pcdh18 UTSW 3 49754705 missense probably damaging 0.99
R1903:Pcdh18 UTSW 3 49755447 missense probably benign
R1956:Pcdh18 UTSW 3 49755951 missense probably benign
R2044:Pcdh18 UTSW 3 49754940 missense probably benign
R2303:Pcdh18 UTSW 3 49755274 missense probably damaging 1.00
R3732:Pcdh18 UTSW 3 49754791 missense probably benign
R3732:Pcdh18 UTSW 3 49754791 missense probably benign
R3733:Pcdh18 UTSW 3 49754791 missense probably benign
R3973:Pcdh18 UTSW 3 49754586 missense probably damaging 1.00
R4281:Pcdh18 UTSW 3 49756533 missense possibly damaging 0.76
R4601:Pcdh18 UTSW 3 49744725 missense probably damaging 1.00
R4631:Pcdh18 UTSW 3 49756441 missense probably damaging 0.99
R4752:Pcdh18 UTSW 3 49755114 missense probably damaging 1.00
R4840:Pcdh18 UTSW 3 49744668 missense probably damaging 0.98
R4867:Pcdh18 UTSW 3 49754664 missense probably damaging 1.00
R5007:Pcdh18 UTSW 3 49754457 missense probably benign 0.23
R5039:Pcdh18 UTSW 3 49754856 missense probably benign
R5169:Pcdh18 UTSW 3 49755966 missense possibly damaging 0.65
R5438:Pcdh18 UTSW 3 49756016 nonsense probably null
R5579:Pcdh18 UTSW 3 49744977 missense probably damaging 1.00
R6000:Pcdh18 UTSW 3 49754464 missense probably damaging 0.99
R6220:Pcdh18 UTSW 3 49745251 missense probably damaging 1.00
R6737:Pcdh18 UTSW 3 49755895 missense probably damaging 0.98
R6789:Pcdh18 UTSW 3 49755915 missense probably benign 0.00
R7011:Pcdh18 UTSW 3 49754782 missense probably benign
R7146:Pcdh18 UTSW 3 49755822 missense probably damaging 1.00
R7150:Pcdh18 UTSW 3 49754694 missense probably benign 0.31
R7205:Pcdh18 UTSW 3 49755474 missense probably benign
R7326:Pcdh18 UTSW 3 49756860 missense probably benign
R7413:Pcdh18 UTSW 3 49744783 missense possibly damaging 0.94
R7755:Pcdh18 UTSW 3 49754829 missense possibly damaging 0.59
R7931:Pcdh18 UTSW 3 49755997 missense possibly damaging 0.54
Predicted Primers PCR Primer
(F):5'- TCCAGGGGACATGAGATTTATGC -3'
(R):5'- CTCCATCCTGAAAATCAGCATTTC -3'

Sequencing Primer
(F):5'- CAGGTTTATTGTCATTGACATCCAC -3'
(R):5'- ATCAGCATTTCGGATTCCAACG -3'
Posted On2019-12-20