Incidental Mutation 'R7848:Fhad1'
ID606723
Institutional Source Beutler Lab
Gene Symbol Fhad1
Ensembl Gene ENSMUSG00000051435
Gene Nameforkhead-associated (FHA) phosphopeptide binding domain 1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.081) question?
Stock #R7848 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location141890438-142015082 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 141905602 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 1197 (M1197K)
Ref Sequence ENSEMBL: ENSMUSP00000101405 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000105779] [ENSMUST00000105780]
Predicted Effect probably benign
Transcript: ENSMUST00000105779
AA Change: M1197K

PolyPhen 2 Score 0.294 (Sensitivity: 0.91; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000101405
Gene: ENSMUSG00000051435
AA Change: M1197K

DomainStartEndE-ValueType
FHA 17 69 8.41e-8 SMART
low complexity region 111 124 N/A INTRINSIC
coiled coil region 307 434 N/A INTRINSIC
coiled coil region 640 915 N/A INTRINSIC
low complexity region 1091 1102 N/A INTRINSIC
coiled coil region 1111 1140 N/A INTRINSIC
coiled coil region 1255 1339 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000105780
AA Change: M1197K

PolyPhen 2 Score 0.294 (Sensitivity: 0.91; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000101406
Gene: ENSMUSG00000051435
AA Change: M1197K

DomainStartEndE-ValueType
FHA 17 69 8.41e-8 SMART
low complexity region 111 124 N/A INTRINSIC
coiled coil region 307 434 N/A INTRINSIC
coiled coil region 640 915 N/A INTRINSIC
low complexity region 1091 1102 N/A INTRINSIC
coiled coil region 1111 1140 N/A INTRINSIC
coiled coil region 1255 1339 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 100% (62/62)
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900026A02Rik C T 5: 113,192,141 A2T probably damaging Het
Abca3 G T 17: 24,384,532 G566V probably damaging Het
Aff4 C A 11: 53,404,512 N846K probably benign Het
Aldh1l2 C T 10: 83,499,843 R714Q probably benign Het
BC027072 T C 17: 71,749,193 D1163G probably benign Het
Cbln1 T C 8: 87,471,700 T126A probably damaging Het
Ccdc84 A G 9: 44,413,642 S139P probably damaging Het
Ccdc85a A G 11: 28,396,123 S446P possibly damaging Het
Ccdc87 A G 19: 4,841,508 Q676R probably damaging Het
Col26a1 T C 5: 136,747,053 K349E possibly damaging Het
Col6a5 T C 9: 105,928,186 I1174V unknown Het
Cyth1 TGGGCAA T 11: 118,183,923 probably null Het
Dmxl1 A G 18: 49,840,490 D64G possibly damaging Het
Dnajc15 T C 14: 77,840,203 H114R probably damaging Het
Espl1 T C 15: 102,316,526 F1390S probably damaging Het
F5 T C 1: 164,161,877 I116T possibly damaging Het
Fam120b T C 17: 15,405,774 V463A possibly damaging Het
Fat4 A G 3: 38,887,851 M298V probably benign Het
Fn1 T A 1: 71,650,601 I127F probably damaging Het
Frmd4a A G 2: 4,591,917 probably benign Het
Gabpb2 A T 3: 95,190,648 V238E probably damaging Het
Gnpat C A 8: 124,886,891 Q626K possibly damaging Het
Gstm7 A T 3: 107,928,586 probably null Het
Gys2 G T 6: 142,446,015 S507* probably null Het
Ippk T A 13: 49,443,496 probably null Het
Itga8 T A 2: 12,191,737 N623I probably damaging Het
Kcnb1 A G 2: 167,106,268 F220S probably damaging Het
Kiz T A 2: 146,889,180 S197T probably benign Het
Klhl42 A G 6: 147,108,100 N479S probably damaging Het
Lims2 A G 18: 31,958,248 *60W probably null Het
Lrch4 A G 5: 137,633,854 N124S probably damaging Het
Man2a2 G C 7: 80,368,865 A82G probably benign Het
Map3k13 T C 16: 21,905,871 V373A probably damaging Het
Mapkapk5 A G 5: 121,545,169 I11T probably benign Het
Mroh2b C T 15: 4,938,379 Q967* probably null Het
Mthfd1l A G 10: 4,083,739 T709A possibly damaging Het
Muc6 T C 7: 141,645,921 T939A possibly damaging Het
Ncam2 C T 16: 81,490,379 H394Y probably benign Het
Ncoa7 A T 10: 30,648,418 N161K possibly damaging Het
Nr2c1 C T 10: 94,190,646 S461L probably benign Het
Nrg3 T C 14: 38,668,283 E323G probably damaging Het
Nufip1 G A 14: 76,114,221 R172H probably damaging Het
Nup210l A G 3: 90,203,905 T1705A probably benign Het
Oaf G A 9: 43,222,780 R215C probably damaging Het
Ogfr T C 2: 180,592,433 L99P probably damaging Het
Olfr1349 T C 7: 6,514,862 D189G probably damaging Het
Olfr644 T A 7: 104,068,095 N312I probably benign Het
Pcdh18 A T 3: 49,755,997 S290T possibly damaging Het
Pklr T G 3: 89,142,978 I378S possibly damaging Het
Rbm12 A T 2: 156,096,216 M712K probably benign Het
Rnase10 T C 14: 51,009,513 V116A possibly damaging Het
Scube3 T C 17: 28,165,595 L621P probably benign Het
Slc35e1 T C 8: 72,492,436 I51V probably benign Het
Smcr8 A G 11: 60,779,924 T633A probably benign Het
St18 T C 1: 6,857,445 probably null Het
Tcrg-V5 G A 13: 19,192,679 V99I probably damaging Het
Tm9sf4 T A 2: 153,202,355 I509N probably damaging Het
Tmcc2 T C 1: 132,360,621 K443E probably damaging Het
Tmem98 T G 11: 80,819,932 V139G probably damaging Het
Ttll1 T C 15: 83,497,372 E232G probably damaging Het
Zfp442 T C 2: 150,411,226 N39D possibly damaging Het
Other mutations in Fhad1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01065:Fhad1 APN 4 141905612 missense probably benign 0.02
IGL01478:Fhad1 APN 4 141951638 missense possibly damaging 0.84
IGL01752:Fhad1 APN 4 141972899 missense possibly damaging 0.82
IGL01788:Fhad1 APN 4 141932802 missense probably benign 0.00
IGL01919:Fhad1 APN 4 141964595 missense probably damaging 0.96
IGL02489:Fhad1 APN 4 141957620 missense probably damaging 0.97
IGL02568:Fhad1 APN 4 141932794 missense probably null 1.00
IGL02583:Fhad1 APN 4 142011644 utr 5 prime probably benign
IGL02716:Fhad1 APN 4 141918331 missense possibly damaging 0.89
IGL02819:Fhad1 APN 4 141918758 missense probably benign 0.23
IGL02820:Fhad1 APN 4 141918758 missense probably benign 0.23
IGL03038:Fhad1 APN 4 142002494 missense probably benign 0.38
IGL03167:Fhad1 APN 4 141972797 missense probably benign 0.00
IGL03255:Fhad1 APN 4 141972880 missense possibly damaging 0.79
R4466_Fhad1_343 UTSW 4 141957658 missense probably damaging 1.00
R4831_Fhad1_494 UTSW 4 141916067 splice site probably null
R5504_Fhad1_818 UTSW 4 141985535 missense probably benign
BB002:Fhad1 UTSW 4 141954187 missense probably damaging 0.97
BB012:Fhad1 UTSW 4 141954187 missense probably damaging 0.97
PIT1430001:Fhad1 UTSW 4 141909749 missense probably damaging 0.99
R0014:Fhad1 UTSW 4 141928408 missense probably damaging 1.00
R0116:Fhad1 UTSW 4 141940095 missense probably benign 0.06
R0143:Fhad1 UTSW 4 141929646 splice site probably benign
R0178:Fhad1 UTSW 4 141955340 missense probably benign 0.31
R0308:Fhad1 UTSW 4 141985593 splice site probably benign
R0384:Fhad1 UTSW 4 142002426 missense probably benign
R0583:Fhad1 UTSW 4 141903990 missense probably benign 0.37
R1501:Fhad1 UTSW 4 141964625 missense probably benign
R1584:Fhad1 UTSW 4 141985511 missense probably benign 0.22
R1615:Fhad1 UTSW 4 141922323 missense probably damaging 0.99
R1991:Fhad1 UTSW 4 141982162 missense possibly damaging 0.75
R2060:Fhad1 UTSW 4 141899249 missense probably benign 0.08
R2079:Fhad1 UTSW 4 141991202 nonsense probably null
R2133:Fhad1 UTSW 4 141928400 missense probably damaging 1.00
R2337:Fhad1 UTSW 4 141922344 missense possibly damaging 0.84
R2843:Fhad1 UTSW 4 141904968 missense probably benign 0.06
R2844:Fhad1 UTSW 4 141904968 missense probably benign 0.06
R2845:Fhad1 UTSW 4 141904968 missense probably benign 0.06
R2846:Fhad1 UTSW 4 141904968 missense probably benign 0.06
R2866:Fhad1 UTSW 4 141920788 missense probably benign 0.00
R3119:Fhad1 UTSW 4 141918307 frame shift probably null
R3760:Fhad1 UTSW 4 141909813 missense probably damaging 1.00
R4180:Fhad1 UTSW 4 141985543 missense possibly damaging 0.69
R4466:Fhad1 UTSW 4 141957658 missense probably damaging 1.00
R4627:Fhad1 UTSW 4 141896468 missense possibly damaging 0.47
R4680:Fhad1 UTSW 4 142011547 nonsense probably null
R4725:Fhad1 UTSW 4 141928378 critical splice donor site probably null
R4755:Fhad1 UTSW 4 141928483 missense probably damaging 1.00
R4831:Fhad1 UTSW 4 141916067 splice site probably null
R4909:Fhad1 UTSW 4 141985511 missense probably benign 0.01
R4968:Fhad1 UTSW 4 141918307 missense probably damaging 1.00
R5004:Fhad1 UTSW 4 142002599 critical splice acceptor site probably null
R5036:Fhad1 UTSW 4 141920741 missense probably benign 0.03
R5048:Fhad1 UTSW 4 141964676 critical splice acceptor site probably null
R5416:Fhad1 UTSW 4 141918802 missense probably benign 0.39
R5504:Fhad1 UTSW 4 141985535 missense probably benign
R5586:Fhad1 UTSW 4 141905131 missense probably benign 0.44
R5692:Fhad1 UTSW 4 141963457 missense probably benign 0.00
R5706:Fhad1 UTSW 4 141954116 missense probably damaging 1.00
R5773:Fhad1 UTSW 4 141929570 missense probably damaging 0.99
R5823:Fhad1 UTSW 4 141955306 missense possibly damaging 0.84
R5833:Fhad1 UTSW 4 142002527 missense probably damaging 1.00
R6170:Fhad1 UTSW 4 141890952 nonsense probably null
R6286:Fhad1 UTSW 4 141920898 missense probably damaging 1.00
R6610:Fhad1 UTSW 4 141916396 missense possibly damaging 0.94
R6755:Fhad1 UTSW 4 141964604 missense probably damaging 1.00
R7006:Fhad1 UTSW 4 141918291 frame shift probably null
R7008:Fhad1 UTSW 4 141918291 frame shift probably null
R7012:Fhad1 UTSW 4 141918291 frame shift probably null
R7014:Fhad1 UTSW 4 141918291 frame shift probably null
R7058:Fhad1 UTSW 4 141918291 frame shift probably null
R7059:Fhad1 UTSW 4 141918291 frame shift probably null
R7060:Fhad1 UTSW 4 141918291 frame shift probably null
R7159:Fhad1 UTSW 4 141951616 missense probably benign 0.01
R7472:Fhad1 UTSW 4 141964626 missense probably benign
R7670:Fhad1 UTSW 4 141951491 missense probably benign 0.01
R7694:Fhad1 UTSW 4 141905064 missense probably benign 0.41
R7745:Fhad1 UTSW 4 141890939 missense probably benign 0.00
R7853:Fhad1 UTSW 4 141909823 missense probably damaging 0.99
R7867:Fhad1 UTSW 4 141905591 missense probably benign 0.00
R7925:Fhad1 UTSW 4 141954187 missense probably damaging 0.97
R8089:Fhad1 UTSW 4 141957660 missense probably damaging 1.00
R8123:Fhad1 UTSW 4 141985525 missense probably benign 0.02
R8711:Fhad1 UTSW 4 141957613 missense probably benign 0.25
R8751:Fhad1 UTSW 4 141918823 missense probably benign 0.04
R8783:Fhad1 UTSW 4 141909092 missense probably benign 0.02
X0018:Fhad1 UTSW 4 141951616 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TCGGGCTGAGTTATGAGAAC -3'
(R):5'- CTGAGAGACCCTGCTCTAGAAAG -3'

Sequencing Primer
(F):5'- TTATGAGAACAAGTCAATAGGGCTC -3'
(R):5'- CCTGCTCTAGAAAGAAGACATCAGAG -3'
Posted On2019-12-20