Incidental Mutation 'R7848:Mapkapk5'
ID606725
Institutional Source Beutler Lab
Gene Symbol Mapkapk5
Ensembl Gene ENSMUSG00000029454
Gene NameMAP kinase-activated protein kinase 5
SynonymsPRAK, MK5
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7848 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location121525038-121545905 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 121545169 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 11 (I11T)
Ref Sequence ENSEMBL: ENSMUSP00000031410 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031410] [ENSMUST00000111782] [ENSMUST00000111783] [ENSMUST00000111786] [ENSMUST00000125946] [ENSMUST00000196315] [ENSMUST00000200170]
Predicted Effect probably benign
Transcript: ENSMUST00000031410
AA Change: I11T

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000031410
Gene: ENSMUSG00000029454
AA Change: I11T

DomainStartEndE-ValueType
S_TKc 22 304 8.22e-84 SMART
coiled coil region 409 434 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111782
AA Change: I11T

PolyPhen 2 Score 0.168 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000107412
Gene: ENSMUSG00000029454
AA Change: I11T

DomainStartEndE-ValueType
Pfam:Pkinase 6 155 3.7e-27 PFAM
coiled coil region 258 283 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000111783
AA Change: I11T

PolyPhen 2 Score 0.951 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000107413
Gene: ENSMUSG00000029454
AA Change: I11T

DomainStartEndE-ValueType
S_TKc 22 304 8.22e-84 SMART
coiled coil region 407 432 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000111786
AA Change: I11T
SMART Domains Protein: ENSMUSP00000107416
Gene: ENSMUSG00000029454
AA Change: I11T

DomainStartEndE-ValueType
Pfam:Pkinase 6 155 3.8e-27 PFAM
coiled coil region 260 285 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000125946
AA Change: I11T

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000142503
Gene: ENSMUSG00000105340
AA Change: I11T

DomainStartEndE-ValueType
S_TKc 22 304 5.3e-84 SMART
coiled coil region 407 432 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000196315
AA Change: I11T

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000142346
Gene: ENSMUSG00000029454
AA Change: I11T

DomainStartEndE-ValueType
STYKc 22 179 4.1e-3 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000200170
AA Change: I11T

PolyPhen 2 Score 0.951 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000143668
Gene: ENSMUSG00000072647
AA Change: I11T

DomainStartEndE-ValueType
S_TKc 22 304 8.22e-84 SMART
coiled coil region 407 432 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 100% (62/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a tumor suppressor and member of the serine/threonine kinase family. In response to cellular stress and proinflammatory cytokines, this kinase is activated through its phosphorylation by MAP kinases including MAPK1/ERK, MAPK14/p38-alpha, and MAPK11/p38-beta. The encoded protein is found in the nucleus but translocates to the cytoplasm upon phosphorylation and activation. This kinase phosphorylates heat shock protein HSP27 at its physiologically relevant sites. Two alternately spliced transcript variants of this gene encoding distinct isoforms have been reported. [provided by RefSeq, Nov 2012]
PHENOTYPE: Homozygous mutant mice are viable, fertile, and show no overt abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900026A02Rik C T 5: 113,192,141 A2T probably damaging Het
Abca3 G T 17: 24,384,532 G566V probably damaging Het
Aff4 C A 11: 53,404,512 N846K probably benign Het
Aldh1l2 C T 10: 83,499,843 R714Q probably benign Het
BC027072 T C 17: 71,749,193 D1163G probably benign Het
Cbln1 T C 8: 87,471,700 T126A probably damaging Het
Ccdc84 A G 9: 44,413,642 S139P probably damaging Het
Ccdc85a A G 11: 28,396,123 S446P possibly damaging Het
Ccdc87 A G 19: 4,841,508 Q676R probably damaging Het
Col26a1 T C 5: 136,747,053 K349E possibly damaging Het
Col6a5 T C 9: 105,928,186 I1174V unknown Het
Cyth1 TGGGCAA T 11: 118,183,923 probably null Het
Dmxl1 A G 18: 49,840,490 D64G possibly damaging Het
Dnajc15 T C 14: 77,840,203 H114R probably damaging Het
Espl1 T C 15: 102,316,526 F1390S probably damaging Het
F5 T C 1: 164,161,877 I116T possibly damaging Het
Fam120b T C 17: 15,405,774 V463A possibly damaging Het
Fat4 A G 3: 38,887,851 M298V probably benign Het
Fhad1 A T 4: 141,905,602 M1197K probably benign Het
Fn1 T A 1: 71,650,601 I127F probably damaging Het
Frmd4a A G 2: 4,591,917 probably benign Het
Gabpb2 A T 3: 95,190,648 V238E probably damaging Het
Gnpat C A 8: 124,886,891 Q626K possibly damaging Het
Gstm7 A T 3: 107,928,586 probably null Het
Gys2 G T 6: 142,446,015 S507* probably null Het
Ippk T A 13: 49,443,496 probably null Het
Itga8 T A 2: 12,191,737 N623I probably damaging Het
Kcnb1 A G 2: 167,106,268 F220S probably damaging Het
Kiz T A 2: 146,889,180 S197T probably benign Het
Klhl42 A G 6: 147,108,100 N479S probably damaging Het
Lims2 A G 18: 31,958,248 *60W probably null Het
Lrch4 A G 5: 137,633,854 N124S probably damaging Het
Man2a2 G C 7: 80,368,865 A82G probably benign Het
Map3k13 T C 16: 21,905,871 V373A probably damaging Het
Mroh2b C T 15: 4,938,379 Q967* probably null Het
Mthfd1l A G 10: 4,083,739 T709A possibly damaging Het
Muc6 T C 7: 141,645,921 T939A possibly damaging Het
Ncam2 C T 16: 81,490,379 H394Y probably benign Het
Ncoa7 A T 10: 30,648,418 N161K possibly damaging Het
Nr2c1 C T 10: 94,190,646 S461L probably benign Het
Nrg3 T C 14: 38,668,283 E323G probably damaging Het
Nufip1 G A 14: 76,114,221 R172H probably damaging Het
Nup210l A G 3: 90,203,905 T1705A probably benign Het
Oaf G A 9: 43,222,780 R215C probably damaging Het
Ogfr T C 2: 180,592,433 L99P probably damaging Het
Olfr1349 T C 7: 6,514,862 D189G probably damaging Het
Olfr644 T A 7: 104,068,095 N312I probably benign Het
Pcdh18 A T 3: 49,755,997 S290T possibly damaging Het
Pklr T G 3: 89,142,978 I378S possibly damaging Het
Rbm12 A T 2: 156,096,216 M712K probably benign Het
Rnase10 T C 14: 51,009,513 V116A possibly damaging Het
Scube3 T C 17: 28,165,595 L621P probably benign Het
Slc35e1 T C 8: 72,492,436 I51V probably benign Het
Smcr8 A G 11: 60,779,924 T633A probably benign Het
St18 T C 1: 6,857,445 probably null Het
Tcrg-V5 G A 13: 19,192,679 V99I probably damaging Het
Tm9sf4 T A 2: 153,202,355 I509N probably damaging Het
Tmcc2 T C 1: 132,360,621 K443E probably damaging Het
Tmem98 T G 11: 80,819,932 V139G probably damaging Het
Ttll1 T C 15: 83,497,372 E232G probably damaging Het
Zfp442 T C 2: 150,411,226 N39D possibly damaging Het
Other mutations in Mapkapk5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00938:Mapkapk5 APN 5 121537103 splice site probably benign
R1015:Mapkapk5 UTSW 5 121533362 missense probably benign 0.17
R2180:Mapkapk5 UTSW 5 121535864 intron probably null
R4445:Mapkapk5 UTSW 5 121525228 missense probably benign
R4539:Mapkapk5 UTSW 5 121537155 missense possibly damaging 0.82
R5217:Mapkapk5 UTSW 5 121534429 missense probably damaging 1.00
R5229:Mapkapk5 UTSW 5 121533391 critical splice acceptor site probably null
R5422:Mapkapk5 UTSW 5 121531722 critical splice acceptor site probably null
R5963:Mapkapk5 UTSW 5 121538481 missense probably damaging 1.00
R6378:Mapkapk5 UTSW 5 121539170 critical splice donor site probably null
R7021:Mapkapk5 UTSW 5 121527211 missense probably benign 0.02
R7303:Mapkapk5 UTSW 5 121540574 missense probably benign 0.02
R7360:Mapkapk5 UTSW 5 121537106 splice site probably benign
R7432:Mapkapk5 UTSW 5 121537171 missense possibly damaging 0.56
RF016:Mapkapk5 UTSW 5 121533316 missense probably damaging 1.00
Z1088:Mapkapk5 UTSW 5 121531591 missense probably benign 0.33
Predicted Primers PCR Primer
(F):5'- CTCTGGGCCTTCAAATGCGG -3'
(R):5'- ACAAAGGCTTGTCCCCAGG -3'

Sequencing Primer
(F):5'- GCCTTCAAATGCGGTCCCC -3'
(R):5'- ACCAGCTTAGAGCCGCCTG -3'
Posted On2019-12-20