Incidental Mutation 'R7848:Olfr1349'
ID606730
Institutional Source Beutler Lab
Gene Symbol Olfr1349
Ensembl Gene ENSMUSG00000048067
Gene Nameolfactory receptor 1349
SynonymsMOR232-8, GA_x6K02T2QGBW-3245761-3244808
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.059) question?
Stock #R7848 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location6513269-6522950 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 6514862 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 189 (D189G)
Ref Sequence ENSEMBL: ENSMUSP00000151168 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051982] [ENSMUST00000207043] [ENSMUST00000207075] [ENSMUST00000207820] [ENSMUST00000213504] [ENSMUST00000213656] [ENSMUST00000216447]
Predicted Effect probably damaging
Transcript: ENSMUST00000051982
AA Change: D189G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000056639
Gene: ENSMUSG00000048067
AA Change: D189G

DomainStartEndE-ValueType
Pfam:7tm_4 40 317 1.9e-47 PFAM
Pfam:7tm_1 50 299 3.3e-18 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000207043
AA Change: D189G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably benign
Transcript: ENSMUST00000207075
Predicted Effect probably damaging
Transcript: ENSMUST00000207820
AA Change: D189G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000213504
AA Change: D189G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000213656
AA Change: D189G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000216447
AA Change: D189G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 100% (62/62)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900026A02Rik C T 5: 113,192,141 A2T probably damaging Het
Abca3 G T 17: 24,384,532 G566V probably damaging Het
Aff4 C A 11: 53,404,512 N846K probably benign Het
Aldh1l2 C T 10: 83,499,843 R714Q probably benign Het
BC027072 T C 17: 71,749,193 D1163G probably benign Het
Cbln1 T C 8: 87,471,700 T126A probably damaging Het
Ccdc84 A G 9: 44,413,642 S139P probably damaging Het
Ccdc85a A G 11: 28,396,123 S446P possibly damaging Het
Ccdc87 A G 19: 4,841,508 Q676R probably damaging Het
Col26a1 T C 5: 136,747,053 K349E possibly damaging Het
Col6a5 T C 9: 105,928,186 I1174V unknown Het
Cyth1 TGGGCAA T 11: 118,183,923 probably null Het
Dmxl1 A G 18: 49,840,490 D64G possibly damaging Het
Dnajc15 T C 14: 77,840,203 H114R probably damaging Het
Espl1 T C 15: 102,316,526 F1390S probably damaging Het
F5 T C 1: 164,161,877 I116T possibly damaging Het
Fam120b T C 17: 15,405,774 V463A possibly damaging Het
Fat4 A G 3: 38,887,851 M298V probably benign Het
Fhad1 A T 4: 141,905,602 M1197K probably benign Het
Fn1 T A 1: 71,650,601 I127F probably damaging Het
Frmd4a A G 2: 4,591,917 probably benign Het
Gabpb2 A T 3: 95,190,648 V238E probably damaging Het
Gnpat C A 8: 124,886,891 Q626K possibly damaging Het
Gstm7 A T 3: 107,928,586 probably null Het
Gys2 G T 6: 142,446,015 S507* probably null Het
Ippk T A 13: 49,443,496 probably null Het
Itga8 T A 2: 12,191,737 N623I probably damaging Het
Kcnb1 A G 2: 167,106,268 F220S probably damaging Het
Kiz T A 2: 146,889,180 S197T probably benign Het
Klhl42 A G 6: 147,108,100 N479S probably damaging Het
Lims2 A G 18: 31,958,248 *60W probably null Het
Lrch4 A G 5: 137,633,854 N124S probably damaging Het
Man2a2 G C 7: 80,368,865 A82G probably benign Het
Map3k13 T C 16: 21,905,871 V373A probably damaging Het
Mapkapk5 A G 5: 121,545,169 I11T probably benign Het
Mroh2b C T 15: 4,938,379 Q967* probably null Het
Mthfd1l A G 10: 4,083,739 T709A possibly damaging Het
Muc6 T C 7: 141,645,921 T939A possibly damaging Het
Ncam2 C T 16: 81,490,379 H394Y probably benign Het
Ncoa7 A T 10: 30,648,418 N161K possibly damaging Het
Nr2c1 C T 10: 94,190,646 S461L probably benign Het
Nrg3 T C 14: 38,668,283 E323G probably damaging Het
Nufip1 G A 14: 76,114,221 R172H probably damaging Het
Nup210l A G 3: 90,203,905 T1705A probably benign Het
Oaf G A 9: 43,222,780 R215C probably damaging Het
Ogfr T C 2: 180,592,433 L99P probably damaging Het
Olfr644 T A 7: 104,068,095 N312I probably benign Het
Pcdh18 A T 3: 49,755,997 S290T possibly damaging Het
Pklr T G 3: 89,142,978 I378S possibly damaging Het
Rbm12 A T 2: 156,096,216 M712K probably benign Het
Rnase10 T C 14: 51,009,513 V116A possibly damaging Het
Scube3 T C 17: 28,165,595 L621P probably benign Het
Slc35e1 T C 8: 72,492,436 I51V probably benign Het
Smcr8 A G 11: 60,779,924 T633A probably benign Het
St18 T C 1: 6,857,445 probably null Het
Tcrg-V5 G A 13: 19,192,679 V99I probably damaging Het
Tm9sf4 T A 2: 153,202,355 I509N probably damaging Het
Tmcc2 T C 1: 132,360,621 K443E probably damaging Het
Tmem98 T G 11: 80,819,932 V139G probably damaging Het
Ttll1 T C 15: 83,497,372 E232G probably damaging Het
Zfp442 T C 2: 150,411,226 N39D possibly damaging Het
Other mutations in Olfr1349
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00917:Olfr1349 APN 7 6514578 missense probably damaging 1.00
IGL02350:Olfr1349 APN 7 6515226 missense probably damaging 1.00
IGL02357:Olfr1349 APN 7 6515226 missense probably damaging 1.00
IGL02955:Olfr1349 APN 7 6514683 missense probably damaging 1.00
R0593:Olfr1349 UTSW 7 6514809 missense probably benign 0.00
R2311:Olfr1349 UTSW 7 6514742 missense probably benign
R2396:Olfr1349 UTSW 7 6514785 missense probably damaging 0.98
R3699:Olfr1349 UTSW 7 6514994 missense probably damaging 0.99
R4095:Olfr1349 UTSW 7 6515253 missense possibly damaging 0.94
R5009:Olfr1349 UTSW 7 6514547 missense probably damaging 0.99
R6818:Olfr1349 UTSW 7 6514551 missense probably damaging 0.99
R7248:Olfr1349 UTSW 7 6514521 missense probably damaging 1.00
R7697:Olfr1349 UTSW 7 6514646 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TACCACTATGAGATGGGAGGCG -3'
(R):5'- TTCTCATGGTCATGGCCTGG -3'

Sequencing Primer
(F):5'- AGGTGGACAGGGCCTTG -3'
(R):5'- GGGATCGCTTTCTGGCCATC -3'
Posted On2019-12-20