Incidental Mutation 'R7848:Slc35e1'
ID606734
Institutional Source Beutler Lab
Gene Symbol Slc35e1
Ensembl Gene ENSMUSG00000019731
Gene Namesolute carrier family 35, member E1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.278) question?
Stock #R7848 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location72480641-72492614 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 72492436 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 51 (I51V)
Ref Sequence ENSEMBL: ENSMUSP00000115754 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058534] [ENSMUST00000152080]
Predicted Effect probably benign
Transcript: ENSMUST00000058534
SMART Domains Protein: ENSMUSP00000058697
Gene: ENSMUSG00000045248

DomainStartEndE-ValueType
TFS2N 12 86 6.67e-21 SMART
low complexity region 93 108 N/A INTRINSIC
Pfam:Med26_M 177 405 3e-80 PFAM
Pfam:Med26_C 407 586 5.1e-91 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000152080
AA Change: I51V

PolyPhen 2 Score 0.080 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000115754
Gene: ENSMUSG00000019731
AA Change: I51V

DomainStartEndE-ValueType
Pfam:TPT 28 333 8.3e-95 PFAM
Pfam:EamA 188 334 7.1e-10 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 100% (62/62)
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900026A02Rik C T 5: 113,192,141 A2T probably damaging Het
Abca3 G T 17: 24,384,532 G566V probably damaging Het
Aff4 C A 11: 53,404,512 N846K probably benign Het
Aldh1l2 C T 10: 83,499,843 R714Q probably benign Het
BC027072 T C 17: 71,749,193 D1163G probably benign Het
Cbln1 T C 8: 87,471,700 T126A probably damaging Het
Ccdc84 A G 9: 44,413,642 S139P probably damaging Het
Ccdc85a A G 11: 28,396,123 S446P possibly damaging Het
Ccdc87 A G 19: 4,841,508 Q676R probably damaging Het
Col26a1 T C 5: 136,747,053 K349E possibly damaging Het
Col6a5 T C 9: 105,928,186 I1174V unknown Het
Cyth1 TGGGCAA T 11: 118,183,923 probably null Het
Dmxl1 A G 18: 49,840,490 D64G possibly damaging Het
Dnajc15 T C 14: 77,840,203 H114R probably damaging Het
Espl1 T C 15: 102,316,526 F1390S probably damaging Het
F5 T C 1: 164,161,877 I116T possibly damaging Het
Fam120b T C 17: 15,405,774 V463A possibly damaging Het
Fat4 A G 3: 38,887,851 M298V probably benign Het
Fhad1 A T 4: 141,905,602 M1197K probably benign Het
Fn1 T A 1: 71,650,601 I127F probably damaging Het
Frmd4a A G 2: 4,591,917 probably benign Het
Gabpb2 A T 3: 95,190,648 V238E probably damaging Het
Gnpat C A 8: 124,886,891 Q626K possibly damaging Het
Gstm7 A T 3: 107,928,586 probably null Het
Gys2 G T 6: 142,446,015 S507* probably null Het
Ippk T A 13: 49,443,496 probably null Het
Itga8 T A 2: 12,191,737 N623I probably damaging Het
Kcnb1 A G 2: 167,106,268 F220S probably damaging Het
Kiz T A 2: 146,889,180 S197T probably benign Het
Klhl42 A G 6: 147,108,100 N479S probably damaging Het
Lims2 A G 18: 31,958,248 *60W probably null Het
Lrch4 A G 5: 137,633,854 N124S probably damaging Het
Man2a2 G C 7: 80,368,865 A82G probably benign Het
Map3k13 T C 16: 21,905,871 V373A probably damaging Het
Mapkapk5 A G 5: 121,545,169 I11T probably benign Het
Mroh2b C T 15: 4,938,379 Q967* probably null Het
Mthfd1l A G 10: 4,083,739 T709A possibly damaging Het
Muc6 T C 7: 141,645,921 T939A possibly damaging Het
Ncam2 C T 16: 81,490,379 H394Y probably benign Het
Ncoa7 A T 10: 30,648,418 N161K possibly damaging Het
Nr2c1 C T 10: 94,190,646 S461L probably benign Het
Nrg3 T C 14: 38,668,283 E323G probably damaging Het
Nufip1 G A 14: 76,114,221 R172H probably damaging Het
Nup210l A G 3: 90,203,905 T1705A probably benign Het
Oaf G A 9: 43,222,780 R215C probably damaging Het
Ogfr T C 2: 180,592,433 L99P probably damaging Het
Olfr1349 T C 7: 6,514,862 D189G probably damaging Het
Olfr644 T A 7: 104,068,095 N312I probably benign Het
Pcdh18 A T 3: 49,755,997 S290T possibly damaging Het
Pklr T G 3: 89,142,978 I378S possibly damaging Het
Rbm12 A T 2: 156,096,216 M712K probably benign Het
Rnase10 T C 14: 51,009,513 V116A possibly damaging Het
Scube3 T C 17: 28,165,595 L621P probably benign Het
Smcr8 A G 11: 60,779,924 T633A probably benign Het
St18 T C 1: 6,857,445 probably null Het
Tcrg-V5 G A 13: 19,192,679 V99I probably damaging Het
Tm9sf4 T A 2: 153,202,355 I509N probably damaging Het
Tmcc2 T C 1: 132,360,621 K443E probably damaging Het
Tmem98 T G 11: 80,819,932 V139G probably damaging Het
Ttll1 T C 15: 83,497,372 E232G probably damaging Het
Zfp442 T C 2: 150,411,226 N39D possibly damaging Het
Other mutations in Slc35e1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01325:Slc35e1 APN 8 72483758 utr 3 prime probably benign
IGL01399:Slc35e1 APN 8 72484690 missense probably damaging 1.00
IGL02663:Slc35e1 APN 8 72488209 missense probably damaging 1.00
IGL03349:Slc35e1 APN 8 72483852 missense probably damaging 0.99
R0009:Slc35e1 UTSW 8 72484709 missense probably damaging 1.00
R0009:Slc35e1 UTSW 8 72484709 missense probably damaging 1.00
R0054:Slc35e1 UTSW 8 72492571 unclassified probably benign
R0105:Slc35e1 UTSW 8 72492571 unclassified probably benign
R0401:Slc35e1 UTSW 8 72492571 unclassified probably benign
R0510:Slc35e1 UTSW 8 72492571 unclassified probably benign
R0511:Slc35e1 UTSW 8 72492571 unclassified probably benign
R0529:Slc35e1 UTSW 8 72492571 unclassified probably benign
R0566:Slc35e1 UTSW 8 72492571 unclassified probably benign
R0968:Slc35e1 UTSW 8 72492571 unclassified probably benign
R0969:Slc35e1 UTSW 8 72492571 unclassified probably benign
R1029:Slc35e1 UTSW 8 72492571 unclassified probably benign
R1051:Slc35e1 UTSW 8 72492571 unclassified probably benign
R1123:Slc35e1 UTSW 8 72492571 unclassified probably benign
R1245:Slc35e1 UTSW 8 72492571 unclassified probably benign
R1247:Slc35e1 UTSW 8 72492571 unclassified probably benign
R1314:Slc35e1 UTSW 8 72492571 unclassified probably benign
R1343:Slc35e1 UTSW 8 72492571 unclassified probably benign
R1357:Slc35e1 UTSW 8 72492571 unclassified probably benign
R1401:Slc35e1 UTSW 8 72492571 unclassified probably benign
R1430:Slc35e1 UTSW 8 72492571 unclassified probably benign
R1715:Slc35e1 UTSW 8 72483977 missense probably benign 0.05
R3031:Slc35e1 UTSW 8 72484891 missense probably benign 0.03
R3769:Slc35e1 UTSW 8 72491870 missense possibly damaging 0.89
R4745:Slc35e1 UTSW 8 72492322 missense possibly damaging 0.81
R6884:Slc35e1 UTSW 8 72484882 missense possibly damaging 0.77
R7309:Slc35e1 UTSW 8 72492514 missense unknown
R7913:Slc35e1 UTSW 8 72484662 missense probably damaging 1.00
R8080:Slc35e1 UTSW 8 72492186 missense probably damaging 1.00
R8806:Slc35e1 UTSW 8 72488129 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCAGTACGTAACGCGGATAG -3'
(R):5'- CCGGAAAGCGTTTAAGTGAG -3'

Sequencing Primer
(F):5'- CGGATAGAAGCGCGGCG -3'
(R):5'- CAATGGTGAGCGGCGTCTG -3'
Posted On2019-12-20