Incidental Mutation 'R7848:Ccdc84'
ID606738
Institutional Source Beutler Lab
Gene Symbol Ccdc84
Ensembl Gene ENSMUSG00000043923
Gene Namecoiled-coil domain containing 84
SynonymsD630044F24Rik, LOC382073
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.856) question?
Stock #R7848 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location44410159-44418569 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 44413642 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 139 (S139P)
Ref Sequence ENSEMBL: ENSMUSP00000053216 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053286] [ENSMUST00000080300] [ENSMUST00000213813] [ENSMUST00000214494] [ENSMUST00000214702] [ENSMUST00000216076] [ENSMUST00000216572] [ENSMUST00000216867] [ENSMUST00000217270] [ENSMUST00000217351]
Predicted Effect probably damaging
Transcript: ENSMUST00000053286
AA Change: S139P

PolyPhen 2 Score 0.970 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000053216
Gene: ENSMUSG00000043923
AA Change: S139P

DomainStartEndE-ValueType
Pfam:CCDC84 6 323 2.5e-95 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000080300
SMART Domains Protein: ENSMUSP00000079180
Gene: ENSMUSG00000009927

DomainStartEndE-ValueType
Pfam:Ribosomal_S25 4 112 6.2e-54 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000213813
AA Change: S139P

PolyPhen 2 Score 0.921 (Sensitivity: 0.81; Specificity: 0.94)
Predicted Effect probably damaging
Transcript: ENSMUST00000214494
AA Change: S139P

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
Predicted Effect probably damaging
Transcript: ENSMUST00000214702
AA Change: S139P

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
Predicted Effect
Predicted Effect probably benign
Transcript: ENSMUST00000216076
Predicted Effect possibly damaging
Transcript: ENSMUST00000216572
AA Change: S139P

PolyPhen 2 Score 0.909 (Sensitivity: 0.81; Specificity: 0.94)
Predicted Effect probably benign
Transcript: ENSMUST00000216867
Predicted Effect probably damaging
Transcript: ENSMUST00000217270
AA Change: S139P

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
Predicted Effect probably damaging
Transcript: ENSMUST00000217351
AA Change: S139P

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 100% (62/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein thought to contain a coiled coil motif. No function has been determined for the encoded protein. A pseudogene of this gene is located on chromosome 20. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Aug 2013]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900026A02Rik C T 5: 113,192,141 A2T probably damaging Het
Abca3 G T 17: 24,384,532 G566V probably damaging Het
Aff4 C A 11: 53,404,512 N846K probably benign Het
Aldh1l2 C T 10: 83,499,843 R714Q probably benign Het
BC027072 T C 17: 71,749,193 D1163G probably benign Het
Cbln1 T C 8: 87,471,700 T126A probably damaging Het
Ccdc85a A G 11: 28,396,123 S446P possibly damaging Het
Ccdc87 A G 19: 4,841,508 Q676R probably damaging Het
Col26a1 T C 5: 136,747,053 K349E possibly damaging Het
Col6a5 T C 9: 105,928,186 I1174V unknown Het
Cyth1 TGGGCAA T 11: 118,183,923 probably null Het
Dmxl1 A G 18: 49,840,490 D64G possibly damaging Het
Dnajc15 T C 14: 77,840,203 H114R probably damaging Het
Espl1 T C 15: 102,316,526 F1390S probably damaging Het
F5 T C 1: 164,161,877 I116T possibly damaging Het
Fam120b T C 17: 15,405,774 V463A possibly damaging Het
Fat4 A G 3: 38,887,851 M298V probably benign Het
Fhad1 A T 4: 141,905,602 M1197K probably benign Het
Fn1 T A 1: 71,650,601 I127F probably damaging Het
Frmd4a A G 2: 4,591,917 probably benign Het
Gabpb2 A T 3: 95,190,648 V238E probably damaging Het
Gnpat C A 8: 124,886,891 Q626K possibly damaging Het
Gstm7 A T 3: 107,928,586 probably null Het
Gys2 G T 6: 142,446,015 S507* probably null Het
Ippk T A 13: 49,443,496 probably null Het
Itga8 T A 2: 12,191,737 N623I probably damaging Het
Kcnb1 A G 2: 167,106,268 F220S probably damaging Het
Kiz T A 2: 146,889,180 S197T probably benign Het
Klhl42 A G 6: 147,108,100 N479S probably damaging Het
Lims2 A G 18: 31,958,248 *60W probably null Het
Lrch4 A G 5: 137,633,854 N124S probably damaging Het
Man2a2 G C 7: 80,368,865 A82G probably benign Het
Map3k13 T C 16: 21,905,871 V373A probably damaging Het
Mapkapk5 A G 5: 121,545,169 I11T probably benign Het
Mroh2b C T 15: 4,938,379 Q967* probably null Het
Mthfd1l A G 10: 4,083,739 T709A possibly damaging Het
Muc6 T C 7: 141,645,921 T939A possibly damaging Het
Ncam2 C T 16: 81,490,379 H394Y probably benign Het
Ncoa7 A T 10: 30,648,418 N161K possibly damaging Het
Nr2c1 C T 10: 94,190,646 S461L probably benign Het
Nrg3 T C 14: 38,668,283 E323G probably damaging Het
Nufip1 G A 14: 76,114,221 R172H probably damaging Het
Nup210l A G 3: 90,203,905 T1705A probably benign Het
Oaf G A 9: 43,222,780 R215C probably damaging Het
Ogfr T C 2: 180,592,433 L99P probably damaging Het
Olfr1349 T C 7: 6,514,862 D189G probably damaging Het
Olfr644 T A 7: 104,068,095 N312I probably benign Het
Pcdh18 A T 3: 49,755,997 S290T possibly damaging Het
Pklr T G 3: 89,142,978 I378S possibly damaging Het
Rbm12 A T 2: 156,096,216 M712K probably benign Het
Rnase10 T C 14: 51,009,513 V116A possibly damaging Het
Scube3 T C 17: 28,165,595 L621P probably benign Het
Slc35e1 T C 8: 72,492,436 I51V probably benign Het
Smcr8 A G 11: 60,779,924 T633A probably benign Het
St18 T C 1: 6,857,445 probably null Het
Tcrg-V5 G A 13: 19,192,679 V99I probably damaging Het
Tm9sf4 T A 2: 153,202,355 I509N probably damaging Het
Tmcc2 T C 1: 132,360,621 K443E probably damaging Het
Tmem98 T G 11: 80,819,932 V139G probably damaging Het
Ttll1 T C 15: 83,497,372 E232G probably damaging Het
Zfp442 T C 2: 150,411,226 N39D possibly damaging Het
Other mutations in Ccdc84
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02187:Ccdc84 APN 9 44410787 unclassified probably benign
IGL03400:Ccdc84 APN 9 44413189 missense probably benign
P0047:Ccdc84 UTSW 9 44413209 splice site probably benign
R1466:Ccdc84 UTSW 9 44413680 splice site probably benign
R1864:Ccdc84 UTSW 9 44417721 missense probably damaging 1.00
R4981:Ccdc84 UTSW 9 44417948 missense probably damaging 1.00
R5341:Ccdc84 UTSW 9 44417109 critical splice donor site probably null
R6024:Ccdc84 UTSW 9 44417952 missense possibly damaging 0.87
R6189:Ccdc84 UTSW 9 44410321 missense probably benign
R7250:Ccdc84 UTSW 9 44412451 critical splice donor site probably null
R7659:Ccdc84 UTSW 9 44413493 missense probably damaging 1.00
R7808:Ccdc84 UTSW 9 44412918 missense probably null 1.00
X0061:Ccdc84 UTSW 9 44417760 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TAAGACAGATCGGACCACTTCC -3'
(R):5'- CAAGGTGCTCCACTTTACCAG -3'

Sequencing Primer
(F):5'- ATCGGACCACTTCCTGCCG -3'
(R):5'- TGCTGGCGGAATGTACAATCAATC -3'
Posted On2019-12-20