Incidental Mutation 'R7848:Nufip1'
ID606753
Institutional Source Beutler Lab
Gene Symbol Nufip1
Ensembl Gene ENSMUSG00000022009
Gene Namenuclear fragile X mental retardation protein interacting protein 1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7848 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location76110891-76137379 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 76114221 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 172 (R172H)
Ref Sequence ENSEMBL: ENSMUSP00000022586 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022585] [ENSMUST00000022586]
Predicted Effect probably benign
Transcript: ENSMUST00000022585
SMART Domains Protein: ENSMUSP00000022585
Gene: ENSMUSG00000022008

DomainStartEndE-ValueType
low complexity region 41 67 N/A INTRINSIC
low complexity region 105 117 N/A INTRINSIC
Pfam:DUF3752 202 338 8.9e-25 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000022586
AA Change: R172H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000022586
Gene: ENSMUSG00000022009
AA Change: R172H

DomainStartEndE-ValueType
low complexity region 38 48 N/A INTRINSIC
low complexity region 80 99 N/A INTRINSIC
ZnF_C2H2 165 187 3.58e-2 SMART
ZnF_C2H2 188 212 5.4e1 SMART
low complexity region 291 304 N/A INTRINSIC
Meta Mutation Damage Score 0.1151 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 100% (62/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nuclear RNA binding protein that contains a C2H2 zinc finger motif and a nuclear localization signal. This protein is associated with the nuclear matrix in perichromatin fibrils and, in neurons, localizes to the cytoplasm in association with endoplasmic reticulum ribosomes. This protein interacts with the fragile X mental retardation protein (FMRP), the tumor suppressor protein BRCA1, upregulates RNA polymerase II transcription, and is involved in box C/D snoRNP biogenesis. A pseudogene of this gene resides on chromosome 6q12. [provided by RefSeq, Feb 2012]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900026A02Rik C T 5: 113,192,141 A2T probably damaging Het
Abca3 G T 17: 24,384,532 G566V probably damaging Het
Aff4 C A 11: 53,404,512 N846K probably benign Het
Aldh1l2 C T 10: 83,499,843 R714Q probably benign Het
BC027072 T C 17: 71,749,193 D1163G probably benign Het
Cbln1 T C 8: 87,471,700 T126A probably damaging Het
Ccdc84 A G 9: 44,413,642 S139P probably damaging Het
Ccdc85a A G 11: 28,396,123 S446P possibly damaging Het
Ccdc87 A G 19: 4,841,508 Q676R probably damaging Het
Col26a1 T C 5: 136,747,053 K349E possibly damaging Het
Col6a5 T C 9: 105,928,186 I1174V unknown Het
Cyth1 TGGGCAA T 11: 118,183,923 probably null Het
Dmxl1 A G 18: 49,840,490 D64G possibly damaging Het
Dnajc15 T C 14: 77,840,203 H114R probably damaging Het
Espl1 T C 15: 102,316,526 F1390S probably damaging Het
F5 T C 1: 164,161,877 I116T possibly damaging Het
Fam120b T C 17: 15,405,774 V463A possibly damaging Het
Fat4 A G 3: 38,887,851 M298V probably benign Het
Fhad1 A T 4: 141,905,602 M1197K probably benign Het
Fn1 T A 1: 71,650,601 I127F probably damaging Het
Frmd4a A G 2: 4,591,917 probably benign Het
Gabpb2 A T 3: 95,190,648 V238E probably damaging Het
Gnpat C A 8: 124,886,891 Q626K possibly damaging Het
Gstm7 A T 3: 107,928,586 probably null Het
Gys2 G T 6: 142,446,015 S507* probably null Het
Ippk T A 13: 49,443,496 probably null Het
Itga8 T A 2: 12,191,737 N623I probably damaging Het
Kcnb1 A G 2: 167,106,268 F220S probably damaging Het
Kiz T A 2: 146,889,180 S197T probably benign Het
Klhl42 A G 6: 147,108,100 N479S probably damaging Het
Lims2 A G 18: 31,958,248 *60W probably null Het
Lrch4 A G 5: 137,633,854 N124S probably damaging Het
Man2a2 G C 7: 80,368,865 A82G probably benign Het
Map3k13 T C 16: 21,905,871 V373A probably damaging Het
Mapkapk5 A G 5: 121,545,169 I11T probably benign Het
Mroh2b C T 15: 4,938,379 Q967* probably null Het
Mthfd1l A G 10: 4,083,739 T709A possibly damaging Het
Muc6 T C 7: 141,645,921 T939A possibly damaging Het
Ncam2 C T 16: 81,490,379 H394Y probably benign Het
Ncoa7 A T 10: 30,648,418 N161K possibly damaging Het
Nr2c1 C T 10: 94,190,646 S461L probably benign Het
Nrg3 T C 14: 38,668,283 E323G probably damaging Het
Nup210l A G 3: 90,203,905 T1705A probably benign Het
Oaf G A 9: 43,222,780 R215C probably damaging Het
Ogfr T C 2: 180,592,433 L99P probably damaging Het
Olfr1349 T C 7: 6,514,862 D189G probably damaging Het
Olfr644 T A 7: 104,068,095 N312I probably benign Het
Pcdh18 A T 3: 49,755,997 S290T possibly damaging Het
Pklr T G 3: 89,142,978 I378S possibly damaging Het
Rbm12 A T 2: 156,096,216 M712K probably benign Het
Rnase10 T C 14: 51,009,513 V116A possibly damaging Het
Scube3 T C 17: 28,165,595 L621P probably benign Het
Slc35e1 T C 8: 72,492,436 I51V probably benign Het
Smcr8 A G 11: 60,779,924 T633A probably benign Het
St18 T C 1: 6,857,445 probably null Het
Tcrg-V5 G A 13: 19,192,679 V99I probably damaging Het
Tm9sf4 T A 2: 153,202,355 I509N probably damaging Het
Tmcc2 T C 1: 132,360,621 K443E probably damaging Het
Tmem98 T G 11: 80,819,932 V139G probably damaging Het
Ttll1 T C 15: 83,497,372 E232G probably damaging Het
Zfp442 T C 2: 150,411,226 N39D possibly damaging Het
Other mutations in Nufip1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03035:Nufip1 APN 14 76115818 missense probably damaging 1.00
R0748:Nufip1 UTSW 14 76111068 missense probably damaging 1.00
R1576:Nufip1 UTSW 14 76134870 missense probably benign 0.00
R1641:Nufip1 UTSW 14 76126252 missense possibly damaging 0.55
R1992:Nufip1 UTSW 14 76134847 missense probably damaging 1.00
R5093:Nufip1 UTSW 14 76110973 missense probably benign 0.12
R5191:Nufip1 UTSW 14 76111989 missense probably damaging 1.00
R5212:Nufip1 UTSW 14 76133098 missense possibly damaging 0.72
R5282:Nufip1 UTSW 14 76114275 critical splice donor site probably null
R5635:Nufip1 UTSW 14 76126146 missense probably damaging 1.00
R5916:Nufip1 UTSW 14 76134900 makesense probably null
R5990:Nufip1 UTSW 14 76114188 missense probably damaging 0.99
R6328:Nufip1 UTSW 14 76111054 missense possibly damaging 0.62
R6333:Nufip1 UTSW 14 76111985 missense probably damaging 1.00
R6697:Nufip1 UTSW 14 76133073 missense probably benign 0.09
R7129:Nufip1 UTSW 14 76134885 missense possibly damaging 0.82
R7585:Nufip1 UTSW 14 76110987 missense probably benign 0.02
R7670:Nufip1 UTSW 14 76111974 frame shift probably null
R7912:Nufip1 UTSW 14 76115002 missense possibly damaging 0.90
R7982:Nufip1 UTSW 14 76126239 missense probably benign
R8202:Nufip1 UTSW 14 76111164 missense probably benign 0.03
X0067:Nufip1 UTSW 14 76130861 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CGAATCTTCATTAGGTCTCCAAC -3'
(R):5'- TACTGTCCCCATGCAGCAAG -3'

Sequencing Primer
(F):5'- CTTCATTAGGTCTCCAACTTGAAATC -3'
(R):5'- TGCAGCAAGTCAGCAAACATTTC -3'
Posted On2019-12-20