Incidental Mutation 'R7848:Dnajc15'
ID606754
Institutional Source Beutler Lab
Gene Symbol Dnajc15
Ensembl Gene ENSMUSG00000022013
Gene NameDnaJ heat shock protein family (Hsp40) member C15
SynonymsDnajd1, 1110003P16Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7848 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location77820681-77875125 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 77840203 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 114 (H114R)
Ref Sequence ENSEMBL: ENSMUSP00000154390 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022590] [ENSMUST00000226459]
Predicted Effect probably benign
Transcript: ENSMUST00000022590
SMART Domains Protein: ENSMUSP00000022590
Gene: ENSMUSG00000022013

DomainStartEndE-ValueType
low complexity region 34 53 N/A INTRINSIC
DnaJ 93 147 6.8e-7 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000226459
AA Change: H114R

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 100% (62/62)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased mitochondrial activity that results in rapid metabolism in fasted mice or mice fed a high fat diet. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900026A02Rik C T 5: 113,192,141 A2T probably damaging Het
Abca3 G T 17: 24,384,532 G566V probably damaging Het
Aff4 C A 11: 53,404,512 N846K probably benign Het
Aldh1l2 C T 10: 83,499,843 R714Q probably benign Het
BC027072 T C 17: 71,749,193 D1163G probably benign Het
Cbln1 T C 8: 87,471,700 T126A probably damaging Het
Ccdc84 A G 9: 44,413,642 S139P probably damaging Het
Ccdc85a A G 11: 28,396,123 S446P possibly damaging Het
Ccdc87 A G 19: 4,841,508 Q676R probably damaging Het
Col26a1 T C 5: 136,747,053 K349E possibly damaging Het
Col6a5 T C 9: 105,928,186 I1174V unknown Het
Cyth1 TGGGCAA T 11: 118,183,923 probably null Het
Dmxl1 A G 18: 49,840,490 D64G possibly damaging Het
Espl1 T C 15: 102,316,526 F1390S probably damaging Het
F5 T C 1: 164,161,877 I116T possibly damaging Het
Fam120b T C 17: 15,405,774 V463A possibly damaging Het
Fat4 A G 3: 38,887,851 M298V probably benign Het
Fhad1 A T 4: 141,905,602 M1197K probably benign Het
Fn1 T A 1: 71,650,601 I127F probably damaging Het
Frmd4a A G 2: 4,591,917 probably benign Het
Gabpb2 A T 3: 95,190,648 V238E probably damaging Het
Gnpat C A 8: 124,886,891 Q626K possibly damaging Het
Gstm7 A T 3: 107,928,586 probably null Het
Gys2 G T 6: 142,446,015 S507* probably null Het
Ippk T A 13: 49,443,496 probably null Het
Itga8 T A 2: 12,191,737 N623I probably damaging Het
Kcnb1 A G 2: 167,106,268 F220S probably damaging Het
Kiz T A 2: 146,889,180 S197T probably benign Het
Klhl42 A G 6: 147,108,100 N479S probably damaging Het
Lims2 A G 18: 31,958,248 *60W probably null Het
Lrch4 A G 5: 137,633,854 N124S probably damaging Het
Man2a2 G C 7: 80,368,865 A82G probably benign Het
Map3k13 T C 16: 21,905,871 V373A probably damaging Het
Mapkapk5 A G 5: 121,545,169 I11T probably benign Het
Mroh2b C T 15: 4,938,379 Q967* probably null Het
Mthfd1l A G 10: 4,083,739 T709A possibly damaging Het
Muc6 T C 7: 141,645,921 T939A possibly damaging Het
Ncam2 C T 16: 81,490,379 H394Y probably benign Het
Ncoa7 A T 10: 30,648,418 N161K possibly damaging Het
Nr2c1 C T 10: 94,190,646 S461L probably benign Het
Nrg3 T C 14: 38,668,283 E323G probably damaging Het
Nufip1 G A 14: 76,114,221 R172H probably damaging Het
Nup210l A G 3: 90,203,905 T1705A probably benign Het
Oaf G A 9: 43,222,780 R215C probably damaging Het
Ogfr T C 2: 180,592,433 L99P probably damaging Het
Olfr1349 T C 7: 6,514,862 D189G probably damaging Het
Olfr644 T A 7: 104,068,095 N312I probably benign Het
Pcdh18 A T 3: 49,755,997 S290T possibly damaging Het
Pklr T G 3: 89,142,978 I378S possibly damaging Het
Rbm12 A T 2: 156,096,216 M712K probably benign Het
Rnase10 T C 14: 51,009,513 V116A possibly damaging Het
Scube3 T C 17: 28,165,595 L621P probably benign Het
Slc35e1 T C 8: 72,492,436 I51V probably benign Het
Smcr8 A G 11: 60,779,924 T633A probably benign Het
St18 T C 1: 6,857,445 probably null Het
Tcrg-V5 G A 13: 19,192,679 V99I probably damaging Het
Tm9sf4 T A 2: 153,202,355 I509N probably damaging Het
Tmcc2 T C 1: 132,360,621 K443E probably damaging Het
Tmem98 T G 11: 80,819,932 V139G probably damaging Het
Ttll1 T C 15: 83,497,372 E232G probably damaging Het
Zfp442 T C 2: 150,411,226 N39D possibly damaging Het
Other mutations in Dnajc15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02607:Dnajc15 APN 14 77840216 missense probably damaging 1.00
R0321:Dnajc15 UTSW 14 77874833 missense possibly damaging 0.90
R1574:Dnajc15 UTSW 14 77826414 missense probably benign 0.00
R1574:Dnajc15 UTSW 14 77826414 missense probably benign 0.00
R3774:Dnajc15 UTSW 14 77856937 critical splice donor site probably null
R4397:Dnajc15 UTSW 14 77874794 splice site probably null
R4747:Dnajc15 UTSW 14 77844456 missense probably benign 0.13
R5704:Dnajc15 UTSW 14 77826458 missense probably damaging 1.00
R8179:Dnajc15 UTSW 14 77852953 missense
Predicted Primers PCR Primer
(F):5'- CATTGGCCATTCAACTCCGAAC -3'
(R):5'- CTGGTTAGTGGGATTAAGCATAAAG -3'

Sequencing Primer
(F):5'- ACAAGCCCCCTGGTGTATTAC -3'
(R):5'- AAGCTTGTAATTTTGTATTTGTCCAC -3'
Posted On2019-12-20