Mutagenetix > Incidental Mutation

Incidental Mutation 'R7848:Mroh2b'

606755

Institutional Source

Beutler Lab

Gene Symbol

Mroh2b

Ensembl Gene

ENSMUSG00000022155

Gene Name

maestro heat-like repeat family member 2B

Synonyms

4930455B06Rik, Heatr7b2

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.117) question?

Stock #

R7848 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

4898737-4962205 bp(+) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

C to T at 4938379 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamine to Stop codon at position 967 (Q967*)

Ref Sequence

ENSEMBL: ENSMUSP00000036148 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000045736]

AlphaFold

Q7M6Y6

Predicted Effect

probably null
Transcript: ENSMUST00000045736
AA Change: Q967*

SMART Domains

Protein: ENSMUSP00000036148
Gene: ENSMUSG00000022155
AA Change: Q967*

Domain	Start	End	E-Value	Type
low complexity region	124	135	N/A	INTRINSIC
low complexity region	824	842	N/A	INTRINSIC
SCOP:d1gw5a_	937	1443	7e-15	SMART

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.3%

Validation Efficiency

100% (62/62)

Allele List at MGI

Other mutations in this stock

Total: 61 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2900026A02Rik	C	T	5: 113,192,141	A2T	probably damaging	Het
Abca3	G	T	17: 24,384,532	G566V	probably damaging	Het
Aff4	C	A	11: 53,404,512	N846K	probably benign	Het
Aldh1l2	C	T	10: 83,499,843	R714Q	probably benign	Het
BC027072	T	C	17: 71,749,193	D1163G	probably benign	Het
Cbln1	T	C	8: 87,471,700	T126A	probably damaging	Het
Ccdc84	A	G	9: 44,413,642	S139P	probably damaging	Het
Ccdc85a	A	G	11: 28,396,123	S446P	possibly damaging	Het
Ccdc87	A	G	19: 4,841,508	Q676R	probably damaging	Het
Col26a1	T	C	5: 136,747,053	K349E	possibly damaging	Het
Col6a5	T	C	9: 105,928,186	I1174V	unknown	Het
Cyth1	TGGGCAA	T	11: 118,183,923		probably null	Het
Dmxl1	A	G	18: 49,840,490	D64G	possibly damaging	Het
Dnajc15	T	C	14: 77,840,203	H114R	probably damaging	Het
Espl1	T	C	15: 102,316,526	F1390S	probably damaging	Het
F5	T	C	1: 164,161,877	I116T	possibly damaging	Het
Fam120b	T	C	17: 15,405,774	V463A	possibly damaging	Het
Fat4	A	G	3: 38,887,851	M298V	probably benign	Het
Fhad1	A	T	4: 141,905,602	M1197K	probably benign	Het
Fn1	T	A	1: 71,650,601	I127F	probably damaging	Het
Frmd4a	A	G	2: 4,591,917		probably benign	Het
Gabpb2	A	T	3: 95,190,648	V238E	probably damaging	Het
Gnpat	C	A	8: 124,886,891	Q626K	possibly damaging	Het
Gstm7	A	T	3: 107,928,586		probably null	Het
Gys2	G	T	6: 142,446,015	S507*	probably null	Het
Ippk	T	A	13: 49,443,496		probably null	Het
Itga8	T	A	2: 12,191,737	N623I	probably damaging	Het
Kcnb1	A	G	2: 167,106,268	F220S	probably damaging	Het
Kiz	T	A	2: 146,889,180	S197T	probably benign	Het
Klhl42	A	G	6: 147,108,100	N479S	probably damaging	Het
Lims2	A	G	18: 31,958,248	*60W	probably null	Het
Lrch4	A	G	5: 137,633,854	N124S	probably damaging	Het
Man2a2	G	C	7: 80,368,865	A82G	probably benign	Het
Map3k13	T	C	16: 21,905,871	V373A	probably damaging	Het
Mapkapk5	A	G	5: 121,545,169	I11T	probably benign	Het
Mthfd1l	A	G	10: 4,083,739	T709A	possibly damaging	Het
Muc6	T	C	7: 141,645,921	T939A	possibly damaging	Het
Ncam2	C	T	16: 81,490,379	H394Y	probably benign	Het
Ncoa7	A	T	10: 30,648,418	N161K	possibly damaging	Het
Nr2c1	C	T	10: 94,190,646	S461L	probably benign	Het
Nrg3	T	C	14: 38,668,283	E323G	probably damaging	Het
Nufip1	G	A	14: 76,114,221	R172H	probably damaging	Het
Nup210l	A	G	3: 90,203,905	T1705A	probably benign	Het
Oaf	G	A	9: 43,222,780	R215C	probably damaging	Het
Ogfr	T	C	2: 180,592,433	L99P	probably damaging	Het
Olfr1349	T	C	7: 6,514,862	D189G	probably damaging	Het
Olfr644	T	A	7: 104,068,095	N312I	probably benign	Het
Pcdh18	A	T	3: 49,755,997	S290T	possibly damaging	Het
Pklr	T	G	3: 89,142,978	I378S	possibly damaging	Het
Rbm12	A	T	2: 156,096,216	M712K	probably benign	Het
Rnase10	T	C	14: 51,009,513	V116A	possibly damaging	Het
Scube3	T	C	17: 28,165,595	L621P	probably benign	Het
Slc35e1	T	C	8: 72,492,436	I51V	probably benign	Het
Smcr8	A	G	11: 60,779,924	T633A	probably benign	Het
St18	T	C	1: 6,857,445		probably null	Het
Tcrg-V5	G	A	13: 19,192,679	V99I	probably damaging	Het
Tm9sf4	T	A	2: 153,202,355	I509N	probably damaging	Het
Tmcc2	T	C	1: 132,360,621	K443E	probably damaging	Het
Tmem98	T	G	11: 80,819,932	V139G	probably damaging	Het
Ttll1	T	C	15: 83,497,372	E232G	probably damaging	Het
Zfp442	T	C	2: 150,411,226	N39D	possibly damaging	Het

Other mutations in Mroh2b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00503:Mroh2b	APN	15	4899197	missense	probably benign
IGL00507:Mroh2b	APN	15	4962127	missense	probably damaging	1.00
IGL00548:Mroh2b	APN	15	4931316	missense	probably benign	0.35
IGL00902:Mroh2b	APN	15	4915222	missense	probably damaging	1.00
IGL00944:Mroh2b	APN	15	4951127	splice site	probably benign
IGL00954:Mroh2b	APN	15	4903054	missense	probably damaging	0.99
IGL01015:Mroh2b	APN	15	4941542	missense	probably damaging	1.00
IGL01134:Mroh2b	APN	15	4915152	missense	probably benign	0.00
IGL01337:Mroh2b	APN	15	4905024	missense	probably benign	0.38
IGL01780:Mroh2b	APN	15	4912000	missense	probably benign	0.01
IGL01919:Mroh2b	APN	15	4923688	missense	probably benign	0.10
IGL02069:Mroh2b	APN	15	4904324	splice site	probably benign
IGL02146:Mroh2b	APN	15	4951294	splice site	probably null
IGL02221:Mroh2b	APN	15	4923641	missense	probably damaging	1.00
IGL02281:Mroh2b	APN	15	4952263	missense	probably benign	0.04
IGL02350:Mroh2b	APN	15	4912000	missense	probably benign	0.01
IGL02357:Mroh2b	APN	15	4912000	missense	probably benign	0.01
IGL02401:Mroh2b	APN	15	4900501	missense	possibly damaging	0.71
IGL02427:Mroh2b	APN	15	4951560	splice site	probably benign
IGL02432:Mroh2b	APN	15	4914186	missense	probably benign
IGL02582:Mroh2b	APN	15	4908515	missense	probably damaging	0.98
IGL02632:Mroh2b	APN	15	4931101	missense	probably damaging	0.99
IGL02741:Mroh2b	APN	15	4905632	missense	probably benign
IGL02811:Mroh2b	APN	15	4915236	missense	possibly damaging	0.55
IGL02826:Mroh2b	APN	15	4962148	missense	probably damaging	0.99
IGL03412:Mroh2b	APN	15	4944372	missense	probably benign	0.14
PIT4468001:Mroh2b	UTSW	15	4912812	missense	probably damaging	1.00
R0024:Mroh2b	UTSW	15	4925627	missense	probably damaging	1.00
R0333:Mroh2b	UTSW	15	4931118	missense	probably damaging	1.00
R0433:Mroh2b	UTSW	15	4941634	missense	probably benign	0.01
R0530:Mroh2b	UTSW	15	4934395	missense	probably damaging	0.97
R1411:Mroh2b	UTSW	15	4918317	missense	probably damaging	1.00
R1457:Mroh2b	UTSW	15	4925684	missense	probably damaging	1.00
R1466:Mroh2b	UTSW	15	4925684	missense	probably damaging	1.00
R1466:Mroh2b	UTSW	15	4925684	missense	probably damaging	1.00
R1472:Mroh2b	UTSW	15	4948655	missense	probably benign	0.00
R1525:Mroh2b	UTSW	15	4951130	splice site	probably null
R1584:Mroh2b	UTSW	15	4925684	missense	probably damaging	1.00
R1605:Mroh2b	UTSW	15	4945090	missense	probably benign	0.08
R1657:Mroh2b	UTSW	15	4931043	nonsense	probably null
R1671:Mroh2b	UTSW	15	4951294	splice site	probably null
R1698:Mroh2b	UTSW	15	4914140	missense	probably benign	0.02
R2002:Mroh2b	UTSW	15	4925684	missense	probably damaging	1.00
R2005:Mroh2b	UTSW	15	4917158	missense	probably damaging	1.00
R2077:Mroh2b	UTSW	15	4944966	missense	probably damaging	1.00
R2179:Mroh2b	UTSW	15	4921446	critical splice donor site	probably null
R2183:Mroh2b	UTSW	15	4918225	splice site	probably null
R3713:Mroh2b	UTSW	15	4943649	missense	probably benign	0.01
R3714:Mroh2b	UTSW	15	4943649	missense	probably benign	0.01
R3747:Mroh2b	UTSW	15	4952246	nonsense	probably null
R3748:Mroh2b	UTSW	15	4952246	nonsense	probably null
R3749:Mroh2b	UTSW	15	4952246	nonsense	probably null
R3750:Mroh2b	UTSW	15	4952246	nonsense	probably null
R3792:Mroh2b	UTSW	15	4923620	missense	probably damaging	1.00
R3872:Mroh2b	UTSW	15	4925061	nonsense	probably null
R4021:Mroh2b	UTSW	15	4925100	missense	possibly damaging	0.75
R4329:Mroh2b	UTSW	15	4931379	missense	probably damaging	0.99
R4456:Mroh2b	UTSW	15	4947925	missense	probably benign	0.21
R4592:Mroh2b	UTSW	15	4918290	missense	probably damaging	1.00
R4836:Mroh2b	UTSW	15	4904270	missense	probably damaging	1.00
R5050:Mroh2b	UTSW	15	4900450	missense	possibly damaging	0.82
R5230:Mroh2b	UTSW	15	4941522	missense	probably benign	0.07
R5342:Mroh2b	UTSW	15	4914133	nonsense	probably null
R5353:Mroh2b	UTSW	15	4917178	missense	probably damaging	1.00
R5368:Mroh2b	UTSW	15	4905572	missense	probably damaging	1.00
R5424:Mroh2b	UTSW	15	4941612	missense	probably damaging	0.98
R5484:Mroh2b	UTSW	15	4908981	missense	possibly damaging	0.92
R5999:Mroh2b	UTSW	15	4912884	splice site	probably null
R6046:Mroh2b	UTSW	15	4951281	missense	probably benign	0.01
R6081:Mroh2b	UTSW	15	4944377	missense	probably damaging	1.00
R6162:Mroh2b	UTSW	15	4915225	missense	probably damaging	1.00
R6165:Mroh2b	UTSW	15	4918350	missense	probably benign	0.23
R6240:Mroh2b	UTSW	15	4934644	missense	probably benign	0.38
R6487:Mroh2b	UTSW	15	4947239	missense	probably damaging	1.00
R6539:Mroh2b	UTSW	15	4905574	missense	probably damaging	1.00
R6616:Mroh2b	UTSW	15	4953282	missense	probably benign	0.36
R6663:Mroh2b	UTSW	15	4947935	missense	probably benign	0.21
R6820:Mroh2b	UTSW	15	4953274	missense	probably damaging	1.00
R6900:Mroh2b	UTSW	15	4908987	missense	probably benign	0.00
R6990:Mroh2b	UTSW	15	4912802	missense	possibly damaging	0.55
R7067:Mroh2b	UTSW	15	4900504	missense	probably benign	0.35
R7092:Mroh2b	UTSW	15	4934678	missense	possibly damaging	0.92
R7102:Mroh2b	UTSW	15	4948003	missense	probably benign	0.06
R7264:Mroh2b	UTSW	15	4921362	missense	possibly damaging	0.81
R7436:Mroh2b	UTSW	15	4941554	missense	probably benign	0.21
R7462:Mroh2b	UTSW	15	4908627	missense	probably damaging	1.00
R7529:Mroh2b	UTSW	15	4949009	missense	probably damaging	1.00
R7575:Mroh2b	UTSW	15	4934605	missense	probably damaging	1.00
R7579:Mroh2b	UTSW	15	4931061	missense	probably benign	0.09
R7605:Mroh2b	UTSW	15	4945023	missense	probably damaging	1.00
R7624:Mroh2b	UTSW	15	4917131	missense	probably damaging	1.00
R7797:Mroh2b	UTSW	15	4949105	missense	probably benign	0.36
R7952:Mroh2b	UTSW	15	4951211	missense	probably damaging	1.00
R7995:Mroh2b	UTSW	15	4921357	nonsense	probably null
R8088:Mroh2b	UTSW	15	4900503	missense	possibly damaging	0.57
R8207:Mroh2b	UTSW	15	4938410	missense	possibly damaging	0.95
R8242:Mroh2b	UTSW	15	4909040	missense	probably benign	0.04
R8248:Mroh2b	UTSW	15	4931104	missense	probably benign	0.40
R8258:Mroh2b	UTSW	15	4911909	missense	probably benign	0.01
R8259:Mroh2b	UTSW	15	4911909	missense	probably benign	0.01
R8304:Mroh2b	UTSW	15	4925637	missense	probably damaging	0.99
R8316:Mroh2b	UTSW	15	4951264	nonsense	probably null
R8345:Mroh2b	UTSW	15	4944326	missense	probably benign	0.09
R8507:Mroh2b	UTSW	15	4949090	missense	probably damaging	1.00
R8728:Mroh2b	UTSW	15	4905640	missense	probably damaging	1.00
R8747:Mroh2b	UTSW	15	4935300	missense	probably damaging	0.99
R8798:Mroh2b	UTSW	15	4948709	missense	probably damaging	1.00
R8814:Mroh2b	UTSW	15	4941625	missense	possibly damaging	0.61
R8856:Mroh2b	UTSW	15	4931028	nonsense	probably null
R8910:Mroh2b	UTSW	15	4931373	missense	probably benign	0.01
R8913:Mroh2b	UTSW	15	4917528	intron	probably benign
R8941:Mroh2b	UTSW	15	4962124	missense	possibly damaging	0.86
R9014:Mroh2b	UTSW	15	4899188	start codon destroyed	probably null	0.95
R9086:Mroh2b	UTSW	15	4953272	critical splice acceptor site	probably null
R9101:Mroh2b	UTSW	15	4900453	missense	probably benign	0.20
R9118:Mroh2b	UTSW	15	4962091	missense	possibly damaging	0.86
R9393:Mroh2b	UTSW	15	4951184	missense	probably benign
R9429:Mroh2b	UTSW	15	4934425	missense	probably damaging	1.00
R9431:Mroh2b	UTSW	15	4934470	missense	probably damaging	1.00
R9443:Mroh2b	UTSW	15	4944339	missense	probably damaging	1.00
R9447:Mroh2b	UTSW	15	4931341	missense	probably damaging	1.00
R9497:Mroh2b	UTSW	15	4921363	missense	probably damaging	0.98
R9588:Mroh2b	UTSW	15	4948648	missense	probably benign	0.00
R9631:Mroh2b	UTSW	15	4917074	missense	probably damaging	0.97
R9686:Mroh2b	UTSW	15	4945123	missense	probably benign	0.34
R9774:Mroh2b	UTSW	15	4914131	missense	probably benign	0.08
X0067:Mroh2b	UTSW	15	4951591	missense	possibly damaging	0.90
Z1177:Mroh2b	UTSW	15	4905005	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CTCCATGGGTAGAAACTGAGGTC -3'
(R):5'- CTTGCTGTCCTCATAACGGG -3'

Sequencing Primer
(F):5'- GTAACACAGAGCTGCCCTTTTGTATG -3'
(R):5'- GGGAGGCCACACTTACTCATTTG -3'

Posted On

2019-12-20