Incidental Mutation 'R7848:Ttll1'
ID606756
Institutional Source Beutler Lab
Gene Symbol Ttll1
Ensembl Gene ENSMUSG00000022442
Gene Nametubulin tyrosine ligase-like 1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.937) question?
Stock #R7848 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location83483769-83510893 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 83497372 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 232 (E232G)
Ref Sequence ENSEMBL: ENSMUSP00000016897 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000016897] [ENSMUST00000109479] [ENSMUST00000109480] [ENSMUST00000154401]
Predicted Effect probably damaging
Transcript: ENSMUST00000016897
AA Change: E232G

PolyPhen 2 Score 0.970 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000016897
Gene: ENSMUSG00000022442
AA Change: E232G

DomainStartEndE-ValueType
Pfam:TTL 50 364 5.3e-115 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000109479
AA Change: E232G

PolyPhen 2 Score 0.970 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000105105
Gene: ENSMUSG00000022442
AA Change: E232G

DomainStartEndE-ValueType
Pfam:TTL 49 297 1.5e-83 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000109480
AA Change: E232G

PolyPhen 2 Score 0.970 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000105106
Gene: ENSMUSG00000022442
AA Change: E232G

DomainStartEndE-ValueType
Pfam:TTL 50 364 6.6e-116 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000154401
SMART Domains Protein: ENSMUSP00000117790
Gene: ENSMUSG00000022442

DomainStartEndE-ValueType
Pfam:TTL 48 89 9e-9 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 100% (62/62)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit short sperm flagellum, abnormal tracheal cilia morphology and function, abnormal mucociliary clearance, and rhinosinitus with coughing or sneezing-like noises. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900026A02Rik C T 5: 113,192,141 A2T probably damaging Het
Abca3 G T 17: 24,384,532 G566V probably damaging Het
Aff4 C A 11: 53,404,512 N846K probably benign Het
Aldh1l2 C T 10: 83,499,843 R714Q probably benign Het
BC027072 T C 17: 71,749,193 D1163G probably benign Het
Cbln1 T C 8: 87,471,700 T126A probably damaging Het
Ccdc84 A G 9: 44,413,642 S139P probably damaging Het
Ccdc85a A G 11: 28,396,123 S446P possibly damaging Het
Ccdc87 A G 19: 4,841,508 Q676R probably damaging Het
Col26a1 T C 5: 136,747,053 K349E possibly damaging Het
Col6a5 T C 9: 105,928,186 I1174V unknown Het
Cyth1 TGGGCAA T 11: 118,183,923 probably null Het
Dmxl1 A G 18: 49,840,490 D64G possibly damaging Het
Dnajc15 T C 14: 77,840,203 H114R probably damaging Het
Espl1 T C 15: 102,316,526 F1390S probably damaging Het
F5 T C 1: 164,161,877 I116T possibly damaging Het
Fam120b T C 17: 15,405,774 V463A possibly damaging Het
Fat4 A G 3: 38,887,851 M298V probably benign Het
Fhad1 A T 4: 141,905,602 M1197K probably benign Het
Fn1 T A 1: 71,650,601 I127F probably damaging Het
Frmd4a A G 2: 4,591,917 probably benign Het
Gabpb2 A T 3: 95,190,648 V238E probably damaging Het
Gnpat C A 8: 124,886,891 Q626K possibly damaging Het
Gstm7 A T 3: 107,928,586 probably null Het
Gys2 G T 6: 142,446,015 S507* probably null Het
Ippk T A 13: 49,443,496 probably null Het
Itga8 T A 2: 12,191,737 N623I probably damaging Het
Kcnb1 A G 2: 167,106,268 F220S probably damaging Het
Kiz T A 2: 146,889,180 S197T probably benign Het
Klhl42 A G 6: 147,108,100 N479S probably damaging Het
Lims2 A G 18: 31,958,248 *60W probably null Het
Lrch4 A G 5: 137,633,854 N124S probably damaging Het
Man2a2 G C 7: 80,368,865 A82G probably benign Het
Map3k13 T C 16: 21,905,871 V373A probably damaging Het
Mapkapk5 A G 5: 121,545,169 I11T probably benign Het
Mroh2b C T 15: 4,938,379 Q967* probably null Het
Mthfd1l A G 10: 4,083,739 T709A possibly damaging Het
Muc6 T C 7: 141,645,921 T939A possibly damaging Het
Ncam2 C T 16: 81,490,379 H394Y probably benign Het
Ncoa7 A T 10: 30,648,418 N161K possibly damaging Het
Nr2c1 C T 10: 94,190,646 S461L probably benign Het
Nrg3 T C 14: 38,668,283 E323G probably damaging Het
Nufip1 G A 14: 76,114,221 R172H probably damaging Het
Nup210l A G 3: 90,203,905 T1705A probably benign Het
Oaf G A 9: 43,222,780 R215C probably damaging Het
Ogfr T C 2: 180,592,433 L99P probably damaging Het
Olfr1349 T C 7: 6,514,862 D189G probably damaging Het
Olfr644 T A 7: 104,068,095 N312I probably benign Het
Pcdh18 A T 3: 49,755,997 S290T possibly damaging Het
Pklr T G 3: 89,142,978 I378S possibly damaging Het
Rbm12 A T 2: 156,096,216 M712K probably benign Het
Rnase10 T C 14: 51,009,513 V116A possibly damaging Het
Scube3 T C 17: 28,165,595 L621P probably benign Het
Slc35e1 T C 8: 72,492,436 I51V probably benign Het
Smcr8 A G 11: 60,779,924 T633A probably benign Het
St18 T C 1: 6,857,445 probably null Het
Tcrg-V5 G A 13: 19,192,679 V99I probably damaging Het
Tm9sf4 T A 2: 153,202,355 I509N probably damaging Het
Tmcc2 T C 1: 132,360,621 K443E probably damaging Het
Tmem98 T G 11: 80,819,932 V139G probably damaging Het
Zfp442 T C 2: 150,411,226 N39D possibly damaging Het
Other mutations in Ttll1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02129:Ttll1 APN 15 83484249 missense probably benign
IGL02744:Ttll1 APN 15 83489577 missense probably benign 0.00
R0639:Ttll1 UTSW 15 83502225 nonsense probably null
R1248:Ttll1 UTSW 15 83502125 missense probably benign 0.13
R1581:Ttll1 UTSW 15 83496277 missense probably damaging 0.99
R1599:Ttll1 UTSW 15 83497354 missense probably benign 0.36
R2264:Ttll1 UTSW 15 83496408 missense probably damaging 1.00
R2923:Ttll1 UTSW 15 83492559 missense probably damaging 0.97
R3786:Ttll1 UTSW 15 83484218 missense probably benign 0.00
R4200:Ttll1 UTSW 15 83492577 missense probably damaging 1.00
R4364:Ttll1 UTSW 15 83499994 missense probably damaging 0.99
R4473:Ttll1 UTSW 15 83492609 missense probably damaging 0.99
R4590:Ttll1 UTSW 15 83497345 missense probably damaging 1.00
R4949:Ttll1 UTSW 15 83502173 missense probably null 1.00
R4970:Ttll1 UTSW 15 83496396 missense probably damaging 1.00
R5112:Ttll1 UTSW 15 83496396 missense probably damaging 1.00
R5231:Ttll1 UTSW 15 83489466 splice site probably null
R5911:Ttll1 UTSW 15 83502281 missense probably benign 0.07
R6368:Ttll1 UTSW 15 83489617 missense probably damaging 1.00
R6636:Ttll1 UTSW 15 83499946 missense probably damaging 1.00
R6959:Ttll1 UTSW 15 83502196 nonsense probably null
R8207:Ttll1 UTSW 15 83500078 missense probably damaging 1.00
R8240:Ttll1 UTSW 15 83492582 missense probably damaging 1.00
R8717:Ttll1 UTSW 15 83489508 missense probably benign 0.01
Z1088:Ttll1 UTSW 15 83498189 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- CTCTGAGTTGCTTCTGGACC -3'
(R):5'- GCTAACATCCACTCTTCTGTTGAG -3'

Sequencing Primer
(F):5'- TTGCTTCTGGACCTCGGGC -3'
(R):5'- TTGAACTCATGACCTCTGGAAGAGC -3'
Posted On2019-12-20