Incidental Mutation 'R7848:Espl1'
ID 606757
Institutional Source Beutler Lab
Gene Symbol Espl1
Ensembl Gene ENSMUSG00000058290
Gene Name extra spindle pole bodies 1, separase
Synonyms SSE, ESP1, PRCE, Cerp, PRCE, separase
MMRRC Submission
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R7848 (G1)
Quality Score 225.009
Status Validated
Chromosome 15
Chromosomal Location 102296266-102324357 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 102316526 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Serine at position 1390 (F1390S)
Ref Sequence ENSEMBL: ENSMUSP00000064465 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064924] [ENSMUST00000229050]
AlphaFold P60330
Predicted Effect probably damaging
Transcript: ENSMUST00000064924
AA Change: F1390S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000064465
Gene: ENSMUSG00000058290
AA Change: F1390S

DomainStartEndE-ValueType
low complexity region 236 245 N/A INTRINSIC
low complexity region 433 445 N/A INTRINSIC
low complexity region 785 794 N/A INTRINSIC
low complexity region 907 918 N/A INTRINSIC
low complexity region 1312 1317 N/A INTRINSIC
low complexity region 1565 1579 N/A INTRINSIC
low complexity region 1625 1636 N/A INTRINSIC
Pfam:Peptidase_C50 1716 2065 4.2e-93 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000229050
AA Change: F1390S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 100% (62/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Stable cohesion between sister chromatids before anaphase and their timely separation during anaphase are critical for chromosome inheritance. In vertebrates, sister chromatid cohesion is released in 2 steps via distinct mechanisms. The first step involves phosphorylation of STAG1 (MIM 604358) or STAG2 (MIM 300826) in the cohesin complex. The second step involves cleavage of the cohesin subunit SCC1 (RAD21; MIM 606462) by ESPL1, or separase, which initiates the final separation of sister chromatids (Sun et al., 2009 [PubMed 19345191]).[supplied by OMIM, Nov 2010]
PHENOTYPE: Homozygous null mice display embryonic lethality before somite formation. Conditional null mice display abnormal mitosis during liver regeneration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900026A02Rik C T 5: 113,192,141 A2T probably damaging Het
Abca3 G T 17: 24,384,532 G566V probably damaging Het
Aff4 C A 11: 53,404,512 N846K probably benign Het
Aldh1l2 C T 10: 83,499,843 R714Q probably benign Het
BC027072 T C 17: 71,749,193 D1163G probably benign Het
Cbln1 T C 8: 87,471,700 T126A probably damaging Het
Ccdc84 A G 9: 44,413,642 S139P probably damaging Het
Ccdc85a A G 11: 28,396,123 S446P possibly damaging Het
Ccdc87 A G 19: 4,841,508 Q676R probably damaging Het
Col26a1 T C 5: 136,747,053 K349E possibly damaging Het
Col6a5 T C 9: 105,928,186 I1174V unknown Het
Cyth1 TGGGCAA T 11: 118,183,923 probably null Het
Dmxl1 A G 18: 49,840,490 D64G possibly damaging Het
Dnajc15 T C 14: 77,840,203 H114R probably damaging Het
F5 T C 1: 164,161,877 I116T possibly damaging Het
Fam120b T C 17: 15,405,774 V463A possibly damaging Het
Fat4 A G 3: 38,887,851 M298V probably benign Het
Fhad1 A T 4: 141,905,602 M1197K probably benign Het
Fn1 T A 1: 71,650,601 I127F probably damaging Het
Frmd4a A G 2: 4,591,917 probably benign Het
Gabpb2 A T 3: 95,190,648 V238E probably damaging Het
Gnpat C A 8: 124,886,891 Q626K possibly damaging Het
Gstm7 A T 3: 107,928,586 probably null Het
Gys2 G T 6: 142,446,015 S507* probably null Het
Ippk T A 13: 49,443,496 probably null Het
Itga8 T A 2: 12,191,737 N623I probably damaging Het
Kcnb1 A G 2: 167,106,268 F220S probably damaging Het
Kiz T A 2: 146,889,180 S197T probably benign Het
Klhl42 A G 6: 147,108,100 N479S probably damaging Het
Lims2 A G 18: 31,958,248 *60W probably null Het
Lrch4 A G 5: 137,633,854 N124S probably damaging Het
Man2a2 G C 7: 80,368,865 A82G probably benign Het
Map3k13 T C 16: 21,905,871 V373A probably damaging Het
Mapkapk5 A G 5: 121,545,169 I11T probably benign Het
Mroh2b C T 15: 4,938,379 Q967* probably null Het
Mthfd1l A G 10: 4,083,739 T709A possibly damaging Het
Muc6 T C 7: 141,645,921 T939A possibly damaging Het
Ncam2 C T 16: 81,490,379 H394Y probably benign Het
Ncoa7 A T 10: 30,648,418 N161K possibly damaging Het
Nr2c1 C T 10: 94,190,646 S461L probably benign Het
Nrg3 T C 14: 38,668,283 E323G probably damaging Het
Nufip1 G A 14: 76,114,221 R172H probably damaging Het
Nup210l A G 3: 90,203,905 T1705A probably benign Het
Oaf G A 9: 43,222,780 R215C probably damaging Het
Ogfr T C 2: 180,592,433 L99P probably damaging Het
Olfr1349 T C 7: 6,514,862 D189G probably damaging Het
Olfr644 T A 7: 104,068,095 N312I probably benign Het
Pcdh18 A T 3: 49,755,997 S290T possibly damaging Het
Pklr T G 3: 89,142,978 I378S possibly damaging Het
Rbm12 A T 2: 156,096,216 M712K probably benign Het
Rnase10 T C 14: 51,009,513 V116A possibly damaging Het
Scube3 T C 17: 28,165,595 L621P probably benign Het
Slc35e1 T C 8: 72,492,436 I51V probably benign Het
Smcr8 A G 11: 60,779,924 T633A probably benign Het
St18 T C 1: 6,857,445 probably null Het
Tcrg-V5 G A 13: 19,192,679 V99I probably damaging Het
Tm9sf4 T A 2: 153,202,355 I509N probably damaging Het
Tmcc2 T C 1: 132,360,621 K443E probably damaging Het
Tmem98 T G 11: 80,819,932 V139G probably damaging Het
Ttll1 T C 15: 83,497,372 E232G probably damaging Het
Zfp442 T C 2: 150,411,226 N39D possibly damaging Het
Other mutations in Espl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00821:Espl1 APN 15 102299813 missense probably damaging 1.00
IGL00839:Espl1 APN 15 102320547 unclassified probably benign
IGL00919:Espl1 APN 15 102298629 missense probably benign 0.03
IGL01125:Espl1 APN 15 102322938 missense probably damaging 1.00
IGL01366:Espl1 APN 15 102319836 missense probably benign 0.00
IGL01488:Espl1 APN 15 102298739 missense probably benign
IGL01554:Espl1 APN 15 102313225 missense probably damaging 1.00
IGL01810:Espl1 APN 15 102298205 missense probably benign
IGL01959:Espl1 APN 15 102305662 splice site probably benign
IGL02267:Espl1 APN 15 102315664 missense probably benign 0.01
IGL02452:Espl1 APN 15 102299839 missense probably damaging 1.00
IGL02469:Espl1 APN 15 102314025 missense probably damaging 1.00
IGL02500:Espl1 APN 15 102315800 missense probably benign
IGL02630:Espl1 APN 15 102296818 missense probably benign 0.11
IGL02687:Espl1 APN 15 102313178 splice site probably benign
IGL02868:Espl1 APN 15 102313990 nonsense probably null
IGL02926:Espl1 APN 15 102299855 missense probably damaging 0.99
R0019:Espl1 UTSW 15 102306319 missense probably null 0.01
R0129:Espl1 UTSW 15 102316648 missense probably benign 0.00
R0184:Espl1 UTSW 15 102299216 missense probably benign 0.01
R0240:Espl1 UTSW 15 102312541 missense probably benign 0.00
R0240:Espl1 UTSW 15 102312541 missense probably benign 0.00
R0267:Espl1 UTSW 15 102313017 missense possibly damaging 0.89
R0423:Espl1 UTSW 15 102303986 nonsense probably null
R0587:Espl1 UTSW 15 102303947 splice site probably benign
R0726:Espl1 UTSW 15 102322598 missense probably benign
R1186:Espl1 UTSW 15 102304039 missense probably benign 0.05
R1282:Espl1 UTSW 15 102315391 missense probably benign 0.00
R1428:Espl1 UTSW 15 102305685 missense probably benign 0.06
R1467:Espl1 UTSW 15 102319858 missense probably benign 0.09
R1467:Espl1 UTSW 15 102319858 missense probably benign 0.09
R1473:Espl1 UTSW 15 102320443 missense possibly damaging 0.63
R1570:Espl1 UTSW 15 102298367 missense probably damaging 0.98
R1639:Espl1 UTSW 15 102320714 missense probably damaging 1.00
R1725:Espl1 UTSW 15 102313221 missense probably benign 0.08
R1748:Espl1 UTSW 15 102298529 missense possibly damaging 0.92
R1845:Espl1 UTSW 15 102299013 missense probably benign
R1938:Espl1 UTSW 15 102305042 missense probably benign 0.00
R1954:Espl1 UTSW 15 102298388 missense probably damaging 1.00
R2009:Espl1 UTSW 15 102312989 missense probably damaging 0.99
R2014:Espl1 UTSW 15 102322714 nonsense probably null
R2067:Espl1 UTSW 15 102299090 missense probably damaging 0.96
R2084:Espl1 UTSW 15 102296851 critical splice donor site probably null
R2164:Espl1 UTSW 15 102319588 missense probably damaging 1.00
R2204:Espl1 UTSW 15 102305905 missense probably damaging 1.00
R2220:Espl1 UTSW 15 102312989 missense probably damaging 0.99
R2237:Espl1 UTSW 15 102315569 missense probably damaging 0.98
R2314:Espl1 UTSW 15 102312989 missense probably damaging 0.99
R3107:Espl1 UTSW 15 102312989 missense probably damaging 0.99
R3108:Espl1 UTSW 15 102312989 missense probably damaging 0.99
R3114:Espl1 UTSW 15 102323204 missense possibly damaging 0.89
R3115:Espl1 UTSW 15 102323204 missense possibly damaging 0.89
R3615:Espl1 UTSW 15 102312989 missense probably damaging 0.99
R3616:Espl1 UTSW 15 102312989 missense probably damaging 0.99
R3732:Espl1 UTSW 15 102312989 missense probably damaging 0.99
R3732:Espl1 UTSW 15 102312989 missense probably damaging 0.99
R3733:Espl1 UTSW 15 102312989 missense probably damaging 0.99
R3958:Espl1 UTSW 15 102312989 missense probably damaging 0.99
R3959:Espl1 UTSW 15 102312989 missense probably damaging 0.99
R3960:Espl1 UTSW 15 102312989 missense probably damaging 0.99
R4062:Espl1 UTSW 15 102312989 missense probably damaging 0.99
R4063:Espl1 UTSW 15 102312989 missense probably damaging 0.99
R4064:Espl1 UTSW 15 102312989 missense probably damaging 0.99
R4165:Espl1 UTSW 15 102312989 missense probably damaging 0.99
R4166:Espl1 UTSW 15 102312989 missense probably damaging 0.99
R4349:Espl1 UTSW 15 102319604 missense probably benign 0.26
R4373:Espl1 UTSW 15 102312989 missense probably damaging 0.99
R4376:Espl1 UTSW 15 102312989 missense probably damaging 0.99
R4377:Espl1 UTSW 15 102312989 missense probably damaging 0.99
R4516:Espl1 UTSW 15 102323236 missense probably benign 0.00
R4595:Espl1 UTSW 15 102298724 missense probably benign 0.01
R4884:Espl1 UTSW 15 102324070 missense possibly damaging 0.84
R4894:Espl1 UTSW 15 102322323 critical splice acceptor site probably null
R4921:Espl1 UTSW 15 102315241 missense probably damaging 0.98
R4931:Espl1 UTSW 15 102305730 missense probably benign 0.02
R4936:Espl1 UTSW 15 102304937 missense probably damaging 1.00
R5000:Espl1 UTSW 15 102298551 missense probably damaging 1.00
R5220:Espl1 UTSW 15 102298577 missense probably benign 0.03
R5329:Espl1 UTSW 15 102312518 missense probably damaging 0.97
R5501:Espl1 UTSW 15 102317130 missense possibly damaging 0.51
R5788:Espl1 UTSW 15 102324030 missense probably damaging 1.00
R5848:Espl1 UTSW 15 102322576 missense probably benign 0.03
R5906:Espl1 UTSW 15 102296851 critical splice donor site probably null
R5978:Espl1 UTSW 15 102315774 missense possibly damaging 0.66
R6111:Espl1 UTSW 15 102299888 missense probably damaging 0.99
R6313:Espl1 UTSW 15 102315812 missense probably benign 0.00
R6414:Espl1 UTSW 15 102315560 missense probably damaging 0.96
R6484:Espl1 UTSW 15 102323500 missense possibly damaging 0.65
R6784:Espl1 UTSW 15 102299225 missense probably benign
R6928:Espl1 UTSW 15 102298907 missense probably benign 0.28
R6995:Espl1 UTSW 15 102304100 missense possibly damaging 0.94
R7053:Espl1 UTSW 15 102316893 critical splice donor site probably null
R7062:Espl1 UTSW 15 102298896 missense probably benign 0.00
R7135:Espl1 UTSW 15 102319524 nonsense probably null
R7154:Espl1 UTSW 15 102324049 missense probably damaging 1.00
R7164:Espl1 UTSW 15 102313203 missense probably damaging 1.00
R7522:Espl1 UTSW 15 102305051 missense probably damaging 1.00
R7894:Espl1 UTSW 15 102304025 missense probably damaging 1.00
R8275:Espl1 UTSW 15 102302753 splice site probably benign
R8752:Espl1 UTSW 15 102306324 missense probably damaging 1.00
R9160:Espl1 UTSW 15 102298518 missense probably damaging 1.00
R9310:Espl1 UTSW 15 102296850 critical splice donor site probably null
R9385:Espl1 UTSW 15 102298750 missense probably damaging 0.99
R9532:Espl1 UTSW 15 102319825 nonsense probably null
R9563:Espl1 UTSW 15 102319798 missense possibly damaging 0.82
R9565:Espl1 UTSW 15 102319798 missense possibly damaging 0.82
R9723:Espl1 UTSW 15 102320735 missense probably benign 0.43
X0062:Espl1 UTSW 15 102298397 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTCTTGCAAACTGAGACCATGG -3'
(R):5'- AGACACAGAGGGGTGCTTTG -3'

Sequencing Primer
(F):5'- CAAACTGAGACCATGGGCTTTTG -3'
(R):5'- GAGTCCTCCCACTGACACTG -3'
Posted On 2019-12-20