Incidental Mutation 'R7848:Map3k13'
ID606758
Institutional Source Beutler Lab
Gene Symbol Map3k13
Ensembl Gene ENSMUSG00000033618
Gene Namemitogen-activated protein kinase kinase kinase 13
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7848 (G1)
Quality Score225.009
Status Validated
Chromosome16
Chromosomal Location21794346-21933439 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 21905871 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 373 (V373A)
Ref Sequence ENSEMBL: ENSMUSP00000047388 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042065] [ENSMUST00000231988] [ENSMUST00000232240]
Predicted Effect probably damaging
Transcript: ENSMUST00000042065
AA Change: V373A

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000047388
Gene: ENSMUSG00000033618
AA Change: V373A

DomainStartEndE-ValueType
low complexity region 7 18 N/A INTRINSIC
low complexity region 119 137 N/A INTRINSIC
Pfam:Pkinase 167 406 3.1e-60 PFAM
Pfam:Pkinase_Tyr 167 406 2.4e-65 PFAM
coiled coil region 456 502 N/A INTRINSIC
low complexity region 578 599 N/A INTRINSIC
low complexity region 632 649 N/A INTRINSIC
low complexity region 805 821 N/A INTRINSIC
low complexity region 833 843 N/A INTRINSIC
low complexity region 932 945 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000231988
AA Change: V373A

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
Predicted Effect probably damaging
Transcript: ENSMUST00000232240
AA Change: V373A

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 100% (62/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of serine/threonine protein kinase family. This kinase contains a dual leucine-zipper motif, and has been shown to form dimers/oligomers through its leucine-zipper motif. This kinase can phosphorylate and activate MAPK8/JNK, MAP2K7/MKK7, which suggests a role in the JNK signaling pathway. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900026A02Rik C T 5: 113,192,141 A2T probably damaging Het
Abca3 G T 17: 24,384,532 G566V probably damaging Het
Aff4 C A 11: 53,404,512 N846K probably benign Het
Aldh1l2 C T 10: 83,499,843 R714Q probably benign Het
BC027072 T C 17: 71,749,193 D1163G probably benign Het
Cbln1 T C 8: 87,471,700 T126A probably damaging Het
Ccdc84 A G 9: 44,413,642 S139P probably damaging Het
Ccdc85a A G 11: 28,396,123 S446P possibly damaging Het
Ccdc87 A G 19: 4,841,508 Q676R probably damaging Het
Col26a1 T C 5: 136,747,053 K349E possibly damaging Het
Col6a5 T C 9: 105,928,186 I1174V unknown Het
Cyth1 TGGGCAA T 11: 118,183,923 probably null Het
Dmxl1 A G 18: 49,840,490 D64G possibly damaging Het
Dnajc15 T C 14: 77,840,203 H114R probably damaging Het
Espl1 T C 15: 102,316,526 F1390S probably damaging Het
F5 T C 1: 164,161,877 I116T possibly damaging Het
Fam120b T C 17: 15,405,774 V463A possibly damaging Het
Fat4 A G 3: 38,887,851 M298V probably benign Het
Fhad1 A T 4: 141,905,602 M1197K probably benign Het
Fn1 T A 1: 71,650,601 I127F probably damaging Het
Frmd4a A G 2: 4,591,917 probably benign Het
Gabpb2 A T 3: 95,190,648 V238E probably damaging Het
Gnpat C A 8: 124,886,891 Q626K possibly damaging Het
Gstm7 A T 3: 107,928,586 probably null Het
Gys2 G T 6: 142,446,015 S507* probably null Het
Ippk T A 13: 49,443,496 probably null Het
Itga8 T A 2: 12,191,737 N623I probably damaging Het
Kcnb1 A G 2: 167,106,268 F220S probably damaging Het
Kiz T A 2: 146,889,180 S197T probably benign Het
Klhl42 A G 6: 147,108,100 N479S probably damaging Het
Lims2 A G 18: 31,958,248 *60W probably null Het
Lrch4 A G 5: 137,633,854 N124S probably damaging Het
Man2a2 G C 7: 80,368,865 A82G probably benign Het
Mapkapk5 A G 5: 121,545,169 I11T probably benign Het
Mroh2b C T 15: 4,938,379 Q967* probably null Het
Mthfd1l A G 10: 4,083,739 T709A possibly damaging Het
Muc6 T C 7: 141,645,921 T939A possibly damaging Het
Ncam2 C T 16: 81,490,379 H394Y probably benign Het
Ncoa7 A T 10: 30,648,418 N161K possibly damaging Het
Nr2c1 C T 10: 94,190,646 S461L probably benign Het
Nrg3 T C 14: 38,668,283 E323G probably damaging Het
Nufip1 G A 14: 76,114,221 R172H probably damaging Het
Nup210l A G 3: 90,203,905 T1705A probably benign Het
Oaf G A 9: 43,222,780 R215C probably damaging Het
Ogfr T C 2: 180,592,433 L99P probably damaging Het
Olfr1349 T C 7: 6,514,862 D189G probably damaging Het
Olfr644 T A 7: 104,068,095 N312I probably benign Het
Pcdh18 A T 3: 49,755,997 S290T possibly damaging Het
Pklr T G 3: 89,142,978 I378S possibly damaging Het
Rbm12 A T 2: 156,096,216 M712K probably benign Het
Rnase10 T C 14: 51,009,513 V116A possibly damaging Het
Scube3 T C 17: 28,165,595 L621P probably benign Het
Slc35e1 T C 8: 72,492,436 I51V probably benign Het
Smcr8 A G 11: 60,779,924 T633A probably benign Het
St18 T C 1: 6,857,445 probably null Het
Tcrg-V5 G A 13: 19,192,679 V99I probably damaging Het
Tm9sf4 T A 2: 153,202,355 I509N probably damaging Het
Tmcc2 T C 1: 132,360,621 K443E probably damaging Het
Tmem98 T G 11: 80,819,932 V139G probably damaging Het
Ttll1 T C 15: 83,497,372 E232G probably damaging Het
Zfp442 T C 2: 150,411,226 N39D possibly damaging Het
Other mutations in Map3k13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00977:Map3k13 APN 16 21921764 missense probably benign 0.00
IGL01092:Map3k13 APN 16 21928016 missense probably damaging 0.97
IGL01958:Map3k13 APN 16 21892123 missense probably benign
IGL02444:Map3k13 APN 16 21914232 missense probably benign 0.19
IGL02503:Map3k13 APN 16 21908704 missense possibly damaging 0.50
IGL02712:Map3k13 APN 16 21905255 missense probably damaging 0.99
IGL03342:Map3k13 APN 16 21892231 missense possibly damaging 0.94
R0086:Map3k13 UTSW 16 21914225 missense probably damaging 0.98
R0124:Map3k13 UTSW 16 21903756 missense possibly damaging 0.95
R0281:Map3k13 UTSW 16 21914157 missense probably damaging 1.00
R0308:Map3k13 UTSW 16 21891988 missense probably benign
R0601:Map3k13 UTSW 16 21905249 missense possibly damaging 0.95
R0669:Map3k13 UTSW 16 21906524 missense probably benign 0.03
R0918:Map3k13 UTSW 16 21926240 missense probably damaging 1.00
R1641:Map3k13 UTSW 16 21903792 missense probably damaging 1.00
R1838:Map3k13 UTSW 16 21914189 missense possibly damaging 0.92
R1891:Map3k13 UTSW 16 21911086 missense probably damaging 1.00
R2125:Map3k13 UTSW 16 21892144 missense probably benign 0.01
R2332:Map3k13 UTSW 16 21898677 splice site probably null
R2361:Map3k13 UTSW 16 21906536 missense probably benign 0.05
R4395:Map3k13 UTSW 16 21898571 missense possibly damaging 0.49
R4505:Map3k13 UTSW 16 21922178 missense probably benign 0.00
R4506:Map3k13 UTSW 16 21922178 missense probably benign 0.00
R4521:Map3k13 UTSW 16 21905775 missense possibly damaging 0.94
R4753:Map3k13 UTSW 16 21892002 missense probably benign
R4952:Map3k13 UTSW 16 21911019 missense probably benign 0.15
R5035:Map3k13 UTSW 16 21921671 missense probably benign 0.03
R5327:Map3k13 UTSW 16 21921647 missense possibly damaging 0.89
R5784:Map3k13 UTSW 16 21898641 missense possibly damaging 0.68
R5831:Map3k13 UTSW 16 21928048 makesense probably null
R5996:Map3k13 UTSW 16 21905245 missense possibly damaging 0.95
R6007:Map3k13 UTSW 16 21905183 missense possibly damaging 0.95
R6546:Map3k13 UTSW 16 21921777 missense probably benign 0.15
R6620:Map3k13 UTSW 16 21892311 missense possibly damaging 0.62
R6683:Map3k13 UTSW 16 21892312 missense probably benign 0.32
R6692:Map3k13 UTSW 16 21905237 missense possibly damaging 0.66
R6695:Map3k13 UTSW 16 21922278 missense probably benign 0.10
R6743:Map3k13 UTSW 16 21892423 missense probably damaging 0.98
R6822:Map3k13 UTSW 16 21922263 missense probably benign 0.00
R6965:Map3k13 UTSW 16 21922150 missense probably benign
R7149:Map3k13 UTSW 16 21925437 missense probably benign 0.04
R7174:Map3k13 UTSW 16 21926256 missense probably damaging 1.00
R7256:Map3k13 UTSW 16 21892238 missense probably benign 0.03
R7400:Map3k13 UTSW 16 21922322 missense probably damaging 1.00
R7733:Map3k13 UTSW 16 21921686 missense probably damaging 1.00
R7871:Map3k13 UTSW 16 21921596 missense probably benign 0.09
R7876:Map3k13 UTSW 16 21922319 missense probably benign 0.00
R7931:Map3k13 UTSW 16 21905871 missense probably damaging 0.98
R7954:Map3k13 UTSW 16 21921596 missense probably benign 0.09
R7959:Map3k13 UTSW 16 21922319 missense probably benign 0.00
R8002:Map3k13 UTSW 16 21905128 missense probably benign 0.05
R8089:Map3k13 UTSW 16 21903817 missense possibly damaging 0.48
Z1176:Map3k13 UTSW 16 21905162 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAGCTGAAGTGTGACTCCAC -3'
(R):5'- TCTGCCCTATTTCACAGGTAAC -3'

Sequencing Primer
(F):5'- AAGTGTGACTCCACCCCCTG -3'
(R):5'- GTGCAAGGTTCTAAAATTCTGCAGC -3'
Posted On2019-12-20