Incidental Mutation 'R7848:Map3k13'
ID 606758
Institutional Source Beutler Lab
Gene Symbol Map3k13
Ensembl Gene ENSMUSG00000033618
Gene Name mitogen-activated protein kinase kinase kinase 13
Synonyms C130026N12Rik
MMRRC Submission 045902-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7848 (G1)
Quality Score 225.009
Status Validated
Chromosome 16
Chromosomal Location 21643923-21752189 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 21724621 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 373 (V373A)
Ref Sequence ENSEMBL: ENSMUSP00000047388 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042065] [ENSMUST00000231988] [ENSMUST00000232240]
AlphaFold Q1HKZ5
Predicted Effect probably damaging
Transcript: ENSMUST00000042065
AA Change: V373A

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000047388
Gene: ENSMUSG00000033618
AA Change: V373A

DomainStartEndE-ValueType
low complexity region 7 18 N/A INTRINSIC
low complexity region 119 137 N/A INTRINSIC
Pfam:Pkinase 167 406 3.1e-60 PFAM
Pfam:Pkinase_Tyr 167 406 2.4e-65 PFAM
coiled coil region 456 502 N/A INTRINSIC
low complexity region 578 599 N/A INTRINSIC
low complexity region 632 649 N/A INTRINSIC
low complexity region 805 821 N/A INTRINSIC
low complexity region 833 843 N/A INTRINSIC
low complexity region 932 945 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000231988
AA Change: V373A

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
Predicted Effect probably damaging
Transcript: ENSMUST00000232240
AA Change: V373A

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 100% (62/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of serine/threonine protein kinase family. This kinase contains a dual leucine-zipper motif, and has been shown to form dimers/oligomers through its leucine-zipper motif. This kinase can phosphorylate and activate MAPK8/JNK, MAP2K7/MKK7, which suggests a role in the JNK signaling pathway. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900026A02Rik C T 5: 113,340,007 (GRCm39) A2T probably damaging Het
Abca3 G T 17: 24,603,506 (GRCm39) G566V probably damaging Het
Aff4 C A 11: 53,295,339 (GRCm39) N846K probably benign Het
Aldh1l2 C T 10: 83,335,707 (GRCm39) R714Q probably benign Het
Cbln1 T C 8: 88,198,328 (GRCm39) T126A probably damaging Het
Ccdc85a A G 11: 28,346,123 (GRCm39) S446P possibly damaging Het
Ccdc87 A G 19: 4,891,536 (GRCm39) Q676R probably damaging Het
Cenatac A G 9: 44,324,939 (GRCm39) S139P probably damaging Het
Col26a1 T C 5: 136,775,907 (GRCm39) K349E possibly damaging Het
Col6a5 T C 9: 105,805,385 (GRCm39) I1174V unknown Het
Cyth1 TGGGCAA T 11: 118,074,749 (GRCm39) probably null Het
Dmxl1 A G 18: 49,973,557 (GRCm39) D64G possibly damaging Het
Dnajc15 T C 14: 78,077,643 (GRCm39) H114R probably damaging Het
Espl1 T C 15: 102,224,961 (GRCm39) F1390S probably damaging Het
F5 T C 1: 163,989,446 (GRCm39) I116T possibly damaging Het
Fam120b T C 17: 15,626,036 (GRCm39) V463A possibly damaging Het
Fat4 A G 3: 38,942,000 (GRCm39) M298V probably benign Het
Fhad1 A T 4: 141,632,913 (GRCm39) M1197K probably benign Het
Fn1 T A 1: 71,689,760 (GRCm39) I127F probably damaging Het
Frmd4a A G 2: 4,596,728 (GRCm39) probably benign Het
Gabpb2 A T 3: 95,097,959 (GRCm39) V238E probably damaging Het
Gnpat C A 8: 125,613,630 (GRCm39) Q626K possibly damaging Het
Gstm7 A T 3: 107,835,902 (GRCm39) probably null Het
Gys2 G T 6: 142,391,741 (GRCm39) S507* probably null Het
Ippk T A 13: 49,596,972 (GRCm39) probably null Het
Itga8 T A 2: 12,196,548 (GRCm39) N623I probably damaging Het
Kcnb1 A G 2: 166,948,188 (GRCm39) F220S probably damaging Het
Kiz T A 2: 146,731,100 (GRCm39) S197T probably benign Het
Klhl42 A G 6: 147,009,598 (GRCm39) N479S probably damaging Het
Lims2 A G 18: 32,091,301 (GRCm39) *60W probably null Het
Lrch4 A G 5: 137,632,116 (GRCm39) N124S probably damaging Het
Man2a2 G C 7: 80,018,613 (GRCm39) A82G probably benign Het
Mapkapk5 A G 5: 121,683,232 (GRCm39) I11T probably benign Het
Mroh2b C T 15: 4,967,861 (GRCm39) Q967* probably null Het
Mthfd1l A G 10: 4,033,739 (GRCm39) T709A possibly damaging Het
Muc6 T C 7: 141,232,188 (GRCm39) T939A possibly damaging Het
Ncam2 C T 16: 81,287,267 (GRCm39) H394Y probably benign Het
Ncoa7 A T 10: 30,524,414 (GRCm39) N161K possibly damaging Het
Nr2c1 C T 10: 94,026,508 (GRCm39) S461L probably benign Het
Nrg3 T C 14: 38,390,240 (GRCm39) E323G probably damaging Het
Nufip1 G A 14: 76,351,661 (GRCm39) R172H probably damaging Het
Nup210l A G 3: 90,111,212 (GRCm39) T1705A probably benign Het
Oaf G A 9: 43,134,077 (GRCm39) R215C probably damaging Het
Ogfr T C 2: 180,234,226 (GRCm39) L99P probably damaging Het
Or10am5 T C 7: 6,517,861 (GRCm39) D189G probably damaging Het
Or51a43 T A 7: 103,717,302 (GRCm39) N312I probably benign Het
Pcare T C 17: 72,056,188 (GRCm39) D1163G probably benign Het
Pcdh18 A T 3: 49,710,446 (GRCm39) S290T possibly damaging Het
Pklr T G 3: 89,050,285 (GRCm39) I378S possibly damaging Het
Rbm12 A T 2: 155,938,136 (GRCm39) M712K probably benign Het
Rnase10 T C 14: 51,246,970 (GRCm39) V116A possibly damaging Het
Scube3 T C 17: 28,384,569 (GRCm39) L621P probably benign Het
Slc35e1 T C 8: 73,246,280 (GRCm39) I51V probably benign Het
Smcr8 A G 11: 60,670,750 (GRCm39) T633A probably benign Het
St18 T C 1: 6,927,669 (GRCm39) probably null Het
Tm9sf4 T A 2: 153,044,275 (GRCm39) I509N probably damaging Het
Tmcc2 T C 1: 132,288,359 (GRCm39) K443E probably damaging Het
Tmem98 T G 11: 80,710,758 (GRCm39) V139G probably damaging Het
Trgv5 G A 13: 19,376,849 (GRCm39) V99I probably damaging Het
Ttll1 T C 15: 83,381,573 (GRCm39) E232G probably damaging Het
Zfp442 T C 2: 150,253,146 (GRCm39) N39D possibly damaging Het
Other mutations in Map3k13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00977:Map3k13 APN 16 21,740,514 (GRCm39) missense probably benign 0.00
IGL01092:Map3k13 APN 16 21,746,766 (GRCm39) missense probably damaging 0.97
IGL01958:Map3k13 APN 16 21,710,873 (GRCm39) missense probably benign
IGL02444:Map3k13 APN 16 21,732,982 (GRCm39) missense probably benign 0.19
IGL02503:Map3k13 APN 16 21,727,454 (GRCm39) missense possibly damaging 0.50
IGL02712:Map3k13 APN 16 21,724,005 (GRCm39) missense probably damaging 0.99
IGL03342:Map3k13 APN 16 21,710,981 (GRCm39) missense possibly damaging 0.94
R0086:Map3k13 UTSW 16 21,732,975 (GRCm39) missense probably damaging 0.98
R0124:Map3k13 UTSW 16 21,722,506 (GRCm39) missense possibly damaging 0.95
R0281:Map3k13 UTSW 16 21,732,907 (GRCm39) missense probably damaging 1.00
R0308:Map3k13 UTSW 16 21,710,738 (GRCm39) missense probably benign
R0601:Map3k13 UTSW 16 21,723,999 (GRCm39) missense possibly damaging 0.95
R0669:Map3k13 UTSW 16 21,725,274 (GRCm39) missense probably benign 0.03
R0918:Map3k13 UTSW 16 21,744,990 (GRCm39) missense probably damaging 1.00
R1641:Map3k13 UTSW 16 21,722,542 (GRCm39) missense probably damaging 1.00
R1838:Map3k13 UTSW 16 21,732,939 (GRCm39) missense possibly damaging 0.92
R1891:Map3k13 UTSW 16 21,729,836 (GRCm39) missense probably damaging 1.00
R2125:Map3k13 UTSW 16 21,710,894 (GRCm39) missense probably benign 0.01
R2332:Map3k13 UTSW 16 21,717,427 (GRCm39) splice site probably null
R2361:Map3k13 UTSW 16 21,725,286 (GRCm39) missense probably benign 0.05
R4395:Map3k13 UTSW 16 21,717,321 (GRCm39) missense possibly damaging 0.49
R4505:Map3k13 UTSW 16 21,740,928 (GRCm39) missense probably benign 0.00
R4506:Map3k13 UTSW 16 21,740,928 (GRCm39) missense probably benign 0.00
R4521:Map3k13 UTSW 16 21,724,525 (GRCm39) missense possibly damaging 0.94
R4753:Map3k13 UTSW 16 21,710,752 (GRCm39) missense probably benign
R4952:Map3k13 UTSW 16 21,729,769 (GRCm39) missense probably benign 0.15
R5035:Map3k13 UTSW 16 21,740,421 (GRCm39) missense probably benign 0.03
R5327:Map3k13 UTSW 16 21,740,397 (GRCm39) missense possibly damaging 0.89
R5784:Map3k13 UTSW 16 21,717,391 (GRCm39) missense possibly damaging 0.68
R5831:Map3k13 UTSW 16 21,746,798 (GRCm39) makesense probably null
R5996:Map3k13 UTSW 16 21,723,995 (GRCm39) missense possibly damaging 0.95
R6007:Map3k13 UTSW 16 21,723,933 (GRCm39) missense possibly damaging 0.95
R6546:Map3k13 UTSW 16 21,740,527 (GRCm39) missense probably benign 0.15
R6620:Map3k13 UTSW 16 21,711,061 (GRCm39) missense possibly damaging 0.62
R6683:Map3k13 UTSW 16 21,711,062 (GRCm39) missense probably benign 0.32
R6692:Map3k13 UTSW 16 21,723,987 (GRCm39) missense possibly damaging 0.66
R6695:Map3k13 UTSW 16 21,741,028 (GRCm39) missense probably benign 0.10
R6743:Map3k13 UTSW 16 21,711,173 (GRCm39) missense probably damaging 0.98
R6822:Map3k13 UTSW 16 21,741,013 (GRCm39) missense probably benign 0.00
R6965:Map3k13 UTSW 16 21,740,900 (GRCm39) missense probably benign
R7149:Map3k13 UTSW 16 21,744,187 (GRCm39) missense probably benign 0.04
R7174:Map3k13 UTSW 16 21,745,006 (GRCm39) missense probably damaging 1.00
R7256:Map3k13 UTSW 16 21,710,988 (GRCm39) missense probably benign 0.03
R7400:Map3k13 UTSW 16 21,741,072 (GRCm39) missense probably damaging 1.00
R7733:Map3k13 UTSW 16 21,740,436 (GRCm39) missense probably damaging 1.00
R7871:Map3k13 UTSW 16 21,740,346 (GRCm39) missense probably benign 0.09
R7876:Map3k13 UTSW 16 21,741,069 (GRCm39) missense probably benign 0.00
R8002:Map3k13 UTSW 16 21,723,878 (GRCm39) missense probably benign 0.05
R8089:Map3k13 UTSW 16 21,722,567 (GRCm39) missense possibly damaging 0.48
R8341:Map3k13 UTSW 16 21,740,334 (GRCm39) nonsense probably null
R8738:Map3k13 UTSW 16 21,745,008 (GRCm39) missense probably damaging 1.00
R8940:Map3k13 UTSW 16 21,727,454 (GRCm39) missense possibly damaging 0.50
R8949:Map3k13 UTSW 16 21,723,882 (GRCm39) missense probably benign 0.05
R9391:Map3k13 UTSW 16 21,740,665 (GRCm39) missense probably benign 0.00
R9749:Map3k13 UTSW 16 21,740,581 (GRCm39) missense probably benign 0.00
R9802:Map3k13 UTSW 16 21,740,518 (GRCm39) missense possibly damaging 0.85
Z1176:Map3k13 UTSW 16 21,723,912 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAGCTGAAGTGTGACTCCAC -3'
(R):5'- TCTGCCCTATTTCACAGGTAAC -3'

Sequencing Primer
(F):5'- AAGTGTGACTCCACCCCCTG -3'
(R):5'- GTGCAAGGTTCTAAAATTCTGCAGC -3'
Posted On 2019-12-20