Incidental Mutation 'R7848:Abca3'
ID606761
Institutional Source Beutler Lab
Gene Symbol Abca3
Ensembl Gene ENSMUSG00000024130
Gene NameATP-binding cassette, sub-family A (ABC1), member 3
SynonymsABC-C, 1810036E22Rik, Abc3
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7848 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location24351950-24410201 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 24384532 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Valine at position 566 (G566V)
Ref Sequence ENSEMBL: ENSMUSP00000045285 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039013] [ENSMUST00000079594] [ENSMUST00000117337]
Predicted Effect probably damaging
Transcript: ENSMUST00000039013
AA Change: G566V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000045285
Gene: ENSMUSG00000024130
AA Change: G566V

DomainStartEndE-ValueType
Pfam:ABC2_membrane_3 21 469 2.1e-29 PFAM
AAA 558 740 5.17e-10 SMART
Pfam:ABC2_membrane_3 923 1323 1.8e-35 PFAM
AAA 1408 1592 1.64e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000079594
AA Change: G566V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000078544
Gene: ENSMUSG00000024130
AA Change: G566V

DomainStartEndE-ValueType
Pfam:ABC2_membrane_3 22 469 2.6e-28 PFAM
AAA 558 740 5.17e-10 SMART
Pfam:ABC2_membrane_3 923 1323 5.5e-39 PFAM
AAA 1408 1592 1.64e-3 SMART
Predicted Effect unknown
Transcript: ENSMUST00000117337
AA Change: G566V
SMART Domains Protein: ENSMUSP00000113538
Gene: ENSMUSG00000024130
AA Change: G566V

DomainStartEndE-ValueType
Pfam:ABC2_membrane_3 21 469 1.3e-29 PFAM
AAA 558 740 5.17e-10 SMART
Pfam:ABC2_membrane_3 761 1068 8.8e-29 PFAM
AAA 1153 1337 1.64e-3 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 100% (62/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intracellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the ABC1 subfamily. Members of the ABC1 subfamily comprise the only major ABC subfamily found exclusively in multicellular eukaryotes. The full transporter encoded by this gene may be involved in development of resistance to xenobiotics and engulfment during programmed cell death. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null mutation display neonatal lethality, respiratory failure, and severely impaired surfactant secretion. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900026A02Rik C T 5: 113,192,141 A2T probably damaging Het
Aff4 C A 11: 53,404,512 N846K probably benign Het
Aldh1l2 C T 10: 83,499,843 R714Q probably benign Het
BC027072 T C 17: 71,749,193 D1163G probably benign Het
Cbln1 T C 8: 87,471,700 T126A probably damaging Het
Ccdc84 A G 9: 44,413,642 S139P probably damaging Het
Ccdc85a A G 11: 28,396,123 S446P possibly damaging Het
Ccdc87 A G 19: 4,841,508 Q676R probably damaging Het
Col26a1 T C 5: 136,747,053 K349E possibly damaging Het
Col6a5 T C 9: 105,928,186 I1174V unknown Het
Cyth1 TGGGCAA T 11: 118,183,923 probably null Het
Dmxl1 A G 18: 49,840,490 D64G possibly damaging Het
Dnajc15 T C 14: 77,840,203 H114R probably damaging Het
Espl1 T C 15: 102,316,526 F1390S probably damaging Het
F5 T C 1: 164,161,877 I116T possibly damaging Het
Fam120b T C 17: 15,405,774 V463A possibly damaging Het
Fat4 A G 3: 38,887,851 M298V probably benign Het
Fhad1 A T 4: 141,905,602 M1197K probably benign Het
Fn1 T A 1: 71,650,601 I127F probably damaging Het
Frmd4a A G 2: 4,591,917 probably benign Het
Gabpb2 A T 3: 95,190,648 V238E probably damaging Het
Gnpat C A 8: 124,886,891 Q626K possibly damaging Het
Gstm7 A T 3: 107,928,586 probably null Het
Gys2 G T 6: 142,446,015 S507* probably null Het
Ippk T A 13: 49,443,496 probably null Het
Itga8 T A 2: 12,191,737 N623I probably damaging Het
Kcnb1 A G 2: 167,106,268 F220S probably damaging Het
Kiz T A 2: 146,889,180 S197T probably benign Het
Klhl42 A G 6: 147,108,100 N479S probably damaging Het
Lims2 A G 18: 31,958,248 *60W probably null Het
Lrch4 A G 5: 137,633,854 N124S probably damaging Het
Man2a2 G C 7: 80,368,865 A82G probably benign Het
Map3k13 T C 16: 21,905,871 V373A probably damaging Het
Mapkapk5 A G 5: 121,545,169 I11T probably benign Het
Mroh2b C T 15: 4,938,379 Q967* probably null Het
Mthfd1l A G 10: 4,083,739 T709A possibly damaging Het
Muc6 T C 7: 141,645,921 T939A possibly damaging Het
Ncam2 C T 16: 81,490,379 H394Y probably benign Het
Ncoa7 A T 10: 30,648,418 N161K possibly damaging Het
Nr2c1 C T 10: 94,190,646 S461L probably benign Het
Nrg3 T C 14: 38,668,283 E323G probably damaging Het
Nufip1 G A 14: 76,114,221 R172H probably damaging Het
Nup210l A G 3: 90,203,905 T1705A probably benign Het
Oaf G A 9: 43,222,780 R215C probably damaging Het
Ogfr T C 2: 180,592,433 L99P probably damaging Het
Olfr1349 T C 7: 6,514,862 D189G probably damaging Het
Olfr644 T A 7: 104,068,095 N312I probably benign Het
Pcdh18 A T 3: 49,755,997 S290T possibly damaging Het
Pklr T G 3: 89,142,978 I378S possibly damaging Het
Rbm12 A T 2: 156,096,216 M712K probably benign Het
Rnase10 T C 14: 51,009,513 V116A possibly damaging Het
Scube3 T C 17: 28,165,595 L621P probably benign Het
Slc35e1 T C 8: 72,492,436 I51V probably benign Het
Smcr8 A G 11: 60,779,924 T633A probably benign Het
St18 T C 1: 6,857,445 probably null Het
Tcrg-V5 G A 13: 19,192,679 V99I probably damaging Het
Tm9sf4 T A 2: 153,202,355 I509N probably damaging Het
Tmcc2 T C 1: 132,360,621 K443E probably damaging Het
Tmem98 T G 11: 80,819,932 V139G probably damaging Het
Ttll1 T C 15: 83,497,372 E232G probably damaging Het
Zfp442 T C 2: 150,411,226 N39D possibly damaging Het
Other mutations in Abca3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00915:Abca3 APN 17 24374246 missense probably damaging 1.00
IGL01538:Abca3 APN 17 24376473 missense possibly damaging 0.64
IGL01633:Abca3 APN 17 24397353 nonsense probably null
IGL01837:Abca3 APN 17 24408697 missense probably damaging 1.00
IGL01986:Abca3 APN 17 24408114 missense probably damaging 1.00
IGL02049:Abca3 APN 17 24376730 nonsense probably null
IGL02186:Abca3 APN 17 24377740 missense possibly damaging 0.95
IGL02794:Abca3 APN 17 24402411 missense probably benign 0.05
IGL02962:Abca3 APN 17 24400409 missense probably damaging 1.00
IGL02963:Abca3 APN 17 24384529 missense probably damaging 1.00
IGL03118:Abca3 APN 17 24400450 missense probably benign 0.17
IGL03144:Abca3 APN 17 24381964 missense probably benign 0.37
R0028:Abca3 UTSW 17 24377724 missense probably benign 0.39
R0278:Abca3 UTSW 17 24381920 missense probably benign 0.09
R0570:Abca3 UTSW 17 24374399 missense probably benign
R0825:Abca3 UTSW 17 24400577 missense probably damaging 1.00
R1164:Abca3 UTSW 17 24402331 missense probably damaging 1.00
R1348:Abca3 UTSW 17 24374238 splice site probably null
R1557:Abca3 UTSW 17 24399980 missense possibly damaging 0.46
R1661:Abca3 UTSW 17 24377842 missense probably damaging 0.99
R1665:Abca3 UTSW 17 24377842 missense probably damaging 0.99
R1754:Abca3 UTSW 17 24377779 missense probably benign 0.00
R1828:Abca3 UTSW 17 24366197 missense probably benign 0.34
R1834:Abca3 UTSW 17 24376692 missense probably benign 0.00
R1996:Abca3 UTSW 17 24387532 missense probably damaging 1.00
R2032:Abca3 UTSW 17 24366082 splice site probably benign
R2100:Abca3 UTSW 17 24408209 missense probably damaging 0.99
R2154:Abca3 UTSW 17 24377719 missense probably damaging 1.00
R2240:Abca3 UTSW 17 24376443 missense probably damaging 0.98
R2281:Abca3 UTSW 17 24376726 missense possibly damaging 0.88
R2994:Abca3 UTSW 17 24384564 missense probably damaging 1.00
R4091:Abca3 UTSW 17 24397482 missense probably damaging 1.00
R4294:Abca3 UTSW 17 24400569 missense possibly damaging 0.96
R4496:Abca3 UTSW 17 24383973 missense possibly damaging 0.93
R4633:Abca3 UTSW 17 24387529 missense probably null 1.00
R4866:Abca3 UTSW 17 24374300 missense probably damaging 0.97
R5022:Abca3 UTSW 17 24374300 missense probably damaging 0.97
R5023:Abca3 UTSW 17 24374300 missense probably damaging 0.97
R5072:Abca3 UTSW 17 24374300 missense probably damaging 0.97
R5073:Abca3 UTSW 17 24374300 missense probably damaging 0.97
R5074:Abca3 UTSW 17 24374300 missense probably damaging 0.97
R5123:Abca3 UTSW 17 24384460 missense possibly damaging 0.95
R5157:Abca3 UTSW 17 24408122 missense probably damaging 1.00
R5183:Abca3 UTSW 17 24374453 missense probably benign 0.39
R5269:Abca3 UTSW 17 24376743 missense possibly damaging 0.95
R5566:Abca3 UTSW 17 24383927 missense probably benign
R5579:Abca3 UTSW 17 24376729 missense probably damaging 0.97
R5620:Abca3 UTSW 17 24396470 missense probably benign 0.05
R5755:Abca3 UTSW 17 24398454 missense probably damaging 1.00
R5954:Abca3 UTSW 17 24397416 missense probably benign 0.00
R6041:Abca3 UTSW 17 24376380 missense probably damaging 0.99
R6187:Abca3 UTSW 17 24408167 missense possibly damaging 0.88
R6253:Abca3 UTSW 17 24397552 missense probably benign 0.01
R6375:Abca3 UTSW 17 24387562 missense possibly damaging 0.96
R6487:Abca3 UTSW 17 24397472 missense possibly damaging 0.81
R6616:Abca3 UTSW 17 24384535 missense probably damaging 1.00
R6632:Abca3 UTSW 17 24384470 missense probably benign
R6781:Abca3 UTSW 17 24374406 missense possibly damaging 0.95
R6918:Abca3 UTSW 17 24408658 missense probably damaging 1.00
R6962:Abca3 UTSW 17 24364726 missense probably benign 0.39
R7163:Abca3 UTSW 17 24364942 missense probably benign
R7199:Abca3 UTSW 17 24377707 missense probably damaging 1.00
R7287:Abca3 UTSW 17 24385887 missense possibly damaging 0.91
R7303:Abca3 UTSW 17 24398521 missense possibly damaging 0.83
R7338:Abca3 UTSW 17 24376743 missense possibly damaging 0.95
R7430:Abca3 UTSW 17 24364958 critical splice donor site probably null
R7437:Abca3 UTSW 17 24400498 missense probably damaging 0.99
R7776:Abca3 UTSW 17 24386276 missense possibly damaging 0.77
R7805:Abca3 UTSW 17 24405154 critical splice donor site probably null
R7811:Abca3 UTSW 17 24397388 missense probably benign 0.00
R7859:Abca3 UTSW 17 24384526 missense probably damaging 1.00
R7877:Abca3 UTSW 17 24384023 nonsense probably null
R7893:Abca3 UTSW 17 24385466 missense probably damaging 1.00
R7910:Abca3 UTSW 17 24385853 missense probably benign 0.09
R7911:Abca3 UTSW 17 24398504 missense probably damaging 1.00
R7931:Abca3 UTSW 17 24384532 missense probably damaging 1.00
R7942:Abca3 UTSW 17 24384526 missense probably damaging 1.00
R7960:Abca3 UTSW 17 24384023 nonsense probably null
R7976:Abca3 UTSW 17 24385466 missense probably damaging 1.00
R7991:Abca3 UTSW 17 24385853 missense probably benign 0.09
R7992:Abca3 UTSW 17 24398504 missense probably damaging 1.00
R8016:Abca3 UTSW 17 24364952 missense probably benign 0.06
R8028:Abca3 UTSW 17 24407697 missense probably benign 0.02
R8150:Abca3 UTSW 17 24396548 missense probably benign 0.08
X0018:Abca3 UTSW 17 24396480 missense possibly damaging 0.63
Z1177:Abca3 UTSW 17 24408236 frame shift probably null
Predicted Primers PCR Primer
(F):5'- AGACGTTAGGGTCGTGTTCC -3'
(R):5'- CAGGTTTGAGCATTCATAGACAGAG -3'

Sequencing Primer
(F):5'- ACGTTAGGGTCGTGTTCCAAAGG -3'
(R):5'- GGAACCATTCATCGGCTCC -3'
Posted On2019-12-20