Incidental Mutation 'R7849:Ttc39a'
ID606794
Institutional Source Beutler Lab
Gene Symbol Ttc39a
Ensembl Gene ENSMUSG00000028555
Gene Nametetratricopeptide repeat domain 39A
Synonyms4922503N01Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7849 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location109406623-109444745 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 109422490 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 109 (V109A)
Ref Sequence ENSEMBL: ENSMUSP00000102229 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064129] [ENSMUST00000106618] [ENSMUST00000106619] [ENSMUST00000124209] [ENSMUST00000139237] [ENSMUST00000153315]
Predicted Effect probably benign
Transcript: ENSMUST00000064129
AA Change: V107A

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000066334
Gene: ENSMUSG00000028555
AA Change: V107A

DomainStartEndE-ValueType
TPR 278 311 7.69e1 SMART
TPR 468 501 6.57e1 SMART
TPR 509 542 1.42e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000106618
AA Change: V109A

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000102229
Gene: ENSMUSG00000028555
AA Change: V109A

DomainStartEndE-ValueType
TPR 280 313 7.69e1 SMART
TPR 470 503 6.57e1 SMART
TPR 511 544 1.42e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000106619
AA Change: V107A

PolyPhen 2 Score 0.184 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000102230
Gene: ENSMUSG00000028555
AA Change: V107A

DomainStartEndE-ValueType
Pfam:DUF3808 27 143 1e-38 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000124209
AA Change: V81A

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000118672
Gene: ENSMUSG00000028555
AA Change: V81A

DomainStartEndE-ValueType
Pfam:DUF3808 1 137 6.6e-51 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000139237
AA Change: V55A

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000121779
Gene: ENSMUSG00000028555
AA Change: V55A

DomainStartEndE-ValueType
Pfam:DUF3808 1 109 7.2e-40 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000153315
AA Change: V81A

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000117621
Gene: ENSMUSG00000028555
AA Change: V81A

DomainStartEndE-ValueType
Pfam:DUF3808 1 160 2.6e-53 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 94 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik T A 3: 37,026,328 I325N Het
Agap1 T C 1: 89,630,419 V143A probably damaging Het
Agmo A G 12: 37,242,045 R2G probably benign Het
Alms1 A T 6: 85,621,497 I1102L possibly damaging Het
Ankrd13a T C 5: 114,791,282 I140T possibly damaging Het
Arhgef10l T A 4: 140,583,934 probably null Het
Atxn2l A T 7: 126,493,173 H967Q possibly damaging Het
B3galnt2 A T 13: 13,994,492 N370I probably benign Het
BC053393 T A 11: 46,577,231 I44K not run Het
Cacna1e C T 1: 154,633,718 D264N probably damaging Het
Ccdc112 A T 18: 46,296,323 Y103N probably benign Het
Ccdc68 A C 18: 69,947,175 E197A probably damaging Het
Cdr1 AAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCC AAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCC X: 61,184,524 probably benign Het
Cntn3 T C 6: 102,265,431 M418V probably benign Het
Cpne4 T A 9: 104,686,519 C32S probably damaging Het
Csf2rb2 A T 15: 78,284,421 S845T probably benign Het
Ctnnd2 T G 15: 31,027,587 V1219G probably damaging Het
Cyp4f14 G A 17: 32,909,351 A230V probably benign Het
Cyth1 TGGGCAA T 11: 118,183,923 probably null Het
Dmxl1 T A 18: 49,961,147 C2897S probably benign Het
Elavl2 T A 4: 91,372,043 probably benign Het
Fam135a T C 1: 24,044,250 E298G probably damaging Het
Fbn1 A T 2: 125,309,485 I2534N probably damaging Het
Fibin A G 2: 110,362,480 S106P probably damaging Het
Fndc3a C T 14: 72,564,660 V568M probably benign Het
Frem2 A G 3: 53,572,374 F1966S probably damaging Het
Gata4 T G 14: 63,204,725 E216A possibly damaging Het
Gmps T A 3: 64,015,563 V649E probably benign Het
Golga4 A T 9: 118,559,311 N1834Y possibly damaging Het
Gpr89 A T 3: 96,871,490 Y422* probably null Het
Gzmc A T 14: 56,232,372 F157Y probably benign Het
Hdhd2 A G 18: 76,965,266 D204G probably damaging Het
Hspa4 T G 11: 53,280,703 T225P possibly damaging Het
Ikbkap A T 4: 56,758,968 S1191T possibly damaging Het
Klhl30 T A 1: 91,359,337 D448E probably benign Het
Kptn A G 7: 16,120,041 Y28C probably damaging Het
Krt10 A T 11: 99,387,606 N242K probably damaging Het
Krt6b A T 15: 101,678,574 N254K probably damaging Het
Lama5 G T 2: 180,201,812 D447E probably damaging Het
Lgr6 T C 1: 134,987,681 Y720C probably damaging Het
Macf1 G C 4: 123,407,599 P1037A probably benign Het
Map3k19 C T 1: 127,823,646 G656D probably benign Het
Mroh7 A C 4: 106,721,090 N130K probably benign Het
Muc16 T C 9: 18,640,505 T4831A probably benign Het
Nfkb1 A T 3: 135,585,412 L533H Het
Oaf G A 9: 43,222,780 R215C probably damaging Het
Olfr1033 G A 2: 86,041,605 V97I probably benign Het
Olfr1265 A G 2: 90,037,282 Y121C probably damaging Het
Olfr151 A G 9: 37,730,707 I92T probably damaging Het
Olfr639 C A 7: 104,012,303 R133L possibly damaging Het
Olfr971 A G 9: 39,840,322 D296G possibly damaging Het
Otub1 T C 19: 7,200,060 D74G probably damaging Het
Oxct2b A G 4: 123,116,887 E200G probably damaging Het
Pcdh1 T C 18: 38,189,609 D1057G probably benign Het
Pkd1 T A 17: 24,586,200 V3242E probably damaging Het
Pkd1l3 CCACAGGTGACATCAGAGACACCTGCATCCAGCAGCCCAACACAGGTGACATCAGAGACACCTGCATCCAGCAGCCCAACACAGGTGACATCAGACACACCTGCATCCAATAGCCCACCACAGGGGACATCAGACACACCTGGATTCAGCAGCCCAACACAGGTGACAACAGCCACACTTGTATCCAGCAGCCCACCACAGGTGACATCAGACACACCTGCATCCAGCAGCCCACCACAGGTGACATCAGACACACCTGCATCCAGCAGCCCACCACAGGTGACATCAGAGACACCTGCATCCAGCAGCCCACCACAGGTGACATCAGACACATCTGCATCCATCAGCCCACCACAGGTAATATCAGACACACCTGCATCCAGCAGCCCACCACAGGTGACATCAGAGACACCTGCATCCAGCAGCCCAACA CCACAGGTGACATCAGAGACACCTGCATCCAGCAGCCCAACACAGGTGACATCAGACACACCTGCATCCAATAGCCCACCACAGGGGACATCAGACACACCTGGATTCAGCAGCCCAACACAGGTGACAACAGCCACACTTGTATCCAGCAGCCCACCACAGGTGACATCAGACACACCTGCATCCAGCAGCCCACCACAGGTGACATCAGACACACCTGCATCCAGCAGCCCACCACAGGTGACATCAGAGACACCTGCATCCAGCAGCCCACCACAGGTGACATCAGACACATCTGCATCCATCAGCCCACCACAGGTAATATCAGACACACCTGCATCCAGCAGCCCACCACAGGTGACATCAGAGACACCTGCATCCAGCAGCCCAACA 8: 109,623,788 probably benign Het
Pla2g4e T A 2: 120,185,322 D247V probably benign Het
Pole T A 5: 110,332,548 M1995K probably benign Het
Ppargc1a T C 5: 51,548,513 E76G probably benign Het
Pten G T 19: 32,799,996 R130L probably damaging Het
Ptprj A T 2: 90,444,460 V1186D probably damaging Het
Rab4a T A 8: 123,806,137 M1K probably null Het
Rapgef3 C A 15: 97,758,390 probably null Het
Rarb C A 14: 16,548,473 V83F probably damaging Het
Rgs22 A T 15: 36,099,712 F410I probably damaging Het
Rhpn2 A C 7: 35,381,487 E459A probably benign Het
Rims4 A T 2: 163,864,054 L220Q probably damaging Het
Robo2 T C 16: 73,973,244 T531A possibly damaging Het
Sbf2 T C 7: 110,372,510 H839R probably damaging Het
Setbp1 T C 18: 78,856,853 R1200G probably benign Het
Slc12a8 C A 16: 33,624,560 P275T probably damaging Het
Slc23a1 G T 18: 35,624,501 T239N probably benign Het
Slc37a3 T A 6: 39,364,583 T40S possibly damaging Het
Speer4c T C 5: 15,710,927 probably null Het
Tet1 A T 10: 62,819,473 H1556Q possibly damaging Het
Tfcp2l1 T A 1: 118,675,595 D454E probably damaging Het
Tmem123 A T 9: 7,790,889 M64L probably benign Het
Tmem62 A T 2: 120,984,372 H172L probably benign Het
Trim15 T G 17: 36,866,872 Y77S probably benign Het
Trim37 T A 11: 87,201,444 V693E possibly damaging Het
Trim65 A G 11: 116,126,256 L460S probably damaging Het
Ttc7 A G 17: 87,292,946 M163V probably null Het
Vps13b T C 15: 35,423,232 S233P probably damaging Het
Vwf T C 6: 125,656,803 L2084P Het
Wasl A G 6: 24,633,923 V114A possibly damaging Het
Wdr5 A G 2: 27,519,451 S62G probably damaging Het
Wfdc11 G T 2: 164,665,525 S4* probably null Het
Wfikkn2 C A 11: 94,238,984 M110I probably benign Het
Wiz T G 17: 32,357,786 E588A probably benign Het
Xylt1 A G 7: 117,656,668 H821R probably benign Het
Zbtb7c A T 18: 76,145,701 H410L probably benign Het
Zc3h18 T A 8: 122,383,971 D186E probably damaging Het
Zfp687 G T 3: 95,010,362 L700I possibly damaging Het
Zmym2 T A 14: 56,946,563 M994K probably benign Het
Other mutations in Ttc39a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00870:Ttc39a APN 4 109442345 splice site probably benign
IGL01143:Ttc39a APN 4 109442813 critical splice donor site probably null
IGL01802:Ttc39a APN 4 109433084 nonsense probably null
IGL01906:Ttc39a APN 4 109421394 missense probably benign 0.04
IGL02115:Ttc39a APN 4 109426294 splice site probably benign
IGL02415:Ttc39a APN 4 109431529 unclassified probably benign
IGL02658:Ttc39a APN 4 109422893 missense probably damaging 1.00
IGL02728:Ttc39a APN 4 109442723 missense probably damaging 1.00
IGL03281:Ttc39a APN 4 109433022 missense possibly damaging 0.84
R0030:Ttc39a UTSW 4 109422973 missense probably benign
R0103:Ttc39a UTSW 4 109421453 intron probably null
R0194:Ttc39a UTSW 4 109444179 missense probably benign
R0561:Ttc39a UTSW 4 109440602 missense probably damaging 1.00
R0603:Ttc39a UTSW 4 109426302 missense probably damaging 1.00
R2132:Ttc39a UTSW 4 109442706 missense probably damaging 1.00
R2203:Ttc39a UTSW 4 109431588 missense probably benign 0.19
R2473:Ttc39a UTSW 4 109442239 missense probably damaging 0.97
R4449:Ttc39a UTSW 4 109442303 missense possibly damaging 0.82
R4809:Ttc39a UTSW 4 109416021 nonsense probably null
R5266:Ttc39a UTSW 4 109422504 missense probably benign 0.04
R5590:Ttc39a UTSW 4 109432987 critical splice acceptor site probably null
R5911:Ttc39a UTSW 4 109422971 missense possibly damaging 0.79
R5930:Ttc39a UTSW 4 109430878 missense probably benign
R7058:Ttc39a UTSW 4 109431566 missense probably damaging 1.00
R7771:Ttc39a UTSW 4 109431450 missense probably damaging 1.00
R7791:Ttc39a UTSW 4 109426347 missense probably benign 0.00
R7932:Ttc39a UTSW 4 109422490 missense probably benign 0.00
X0013:Ttc39a UTSW 4 109433137 missense probably benign 0.02
Z1177:Ttc39a UTSW 4 109430932 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTGCCCACAAACCTTCAAATATTTG -3'
(R):5'- TTCCTCCAAAGGCCAAAGG -3'

Sequencing Primer
(F):5'- CAAAGTGTGCCTGTGTGTG -3'
(R):5'- CCAAAGGCCAGGCATTCG -3'
Posted On2019-12-20