Incidental Mutation 'R7849:Vwf'
ID606806
Institutional Source Beutler Lab
Gene Symbol Vwf
Ensembl Gene ENSMUSG00000001930
Gene NameVon Willebrand factor
Synonyms6820430P06Rik, B130011O06Rik
Accession Numbers

Genbank: NM_011708; MGI: 98941

Is this an essential gene? Probably non essential (E-score: 0.205) question?
Stock #R7849 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location125546774-125686679 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 125656803 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 2084 (L2084P)
Ref Sequence ENSEMBL: ENSMUSP00000107873 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000112254]
Predicted Effect
SMART Domains Protein: ENSMUSP00000107873
Gene: ENSMUSG00000001930
AA Change: L2084P

DomainStartEndE-ValueType
VWD 23 181 3.43e-35 SMART
C8 221 295 1.11e-21 SMART
Pfam:TIL 298 351 6.9e-15 PFAM
VWC 353 413 8.71e-1 SMART
VWD 380 543 2.93e-52 SMART
C8 580 652 3.82e-25 SMART
Pfam:TIL 655 710 4.1e-14 PFAM
EGF_like 790 825 4.37e1 SMART
VWC 832 901 3.29e-3 SMART
VWD 859 1015 5.15e-39 SMART
C8 1056 1130 1.01e-33 SMART
Pfam:TIL 1144 1199 1.3e-9 PFAM
VWA 1278 1461 1.81e-20 SMART
low complexity region 1464 1477 N/A INTRINSIC
VWA 1499 1672 8.43e-39 SMART
VWA 1692 1875 2.83e-31 SMART
VWC 1882 1949 2.99e0 SMART
VWD 1941 2104 5.03e-42 SMART
C8 2135 2203 1.29e-13 SMART
Pfam:TIL 2206 2257 8.3e-8 PFAM
VWC 2260 2328 3.16e-16 SMART
low complexity region 2417 2428 N/A INTRINSIC
VWC 2434 2497 2.61e-17 SMART
VWC 2513 2577 3.37e0 SMART
VWC 2585 2647 2.55e-11 SMART
CT 2730 2815 1.37e-31 SMART
Predicted Effect
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a glycoprotein involved in hemostasis. The encoded preproprotein is proteolytically processed following assembly into large multimeric complexes. These complexes function in the adhesion of platelets to sites of vascular injury and the transport of various proteins in the blood. Mutations in this gene result in von Willebrand disease, an inherited bleeding disorder. An unprocessed pseudogene has been found on chromosome 22. [provided by RefSeq, Oct 2015]
PHENOTYPE: Homozygous null mutants exhibit hemostatic and thrombotic defects similar to human von Willebrand disease. Mutants have prolonged bleeding time, newborns occasionally show fatal intra-abdominal bleeding and some adults have detectable fecal occult blood. [provided by MGI curators]
Allele List at MGI

All alleles(33) : Targeted, knock-out(1) Gene trapped(32)

Other mutations in this stock
Total: 94 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik T A 3: 37,026,328 I325N Het
Agap1 T C 1: 89,630,419 V143A probably damaging Het
Agmo A G 12: 37,242,045 R2G probably benign Het
Alms1 A T 6: 85,621,497 I1102L possibly damaging Het
Ankrd13a T C 5: 114,791,282 I140T possibly damaging Het
Arhgef10l T A 4: 140,583,934 probably null Het
Atxn2l A T 7: 126,493,173 H967Q possibly damaging Het
B3galnt2 A T 13: 13,994,492 N370I probably benign Het
BC053393 T A 11: 46,577,231 I44K not run Het
Cacna1e C T 1: 154,633,718 D264N probably damaging Het
Ccdc112 A T 18: 46,296,323 Y103N probably benign Het
Ccdc68 A C 18: 69,947,175 E197A probably damaging Het
Cdr1 AAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCC AAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCC X: 61,184,524 probably benign Het
Cntn3 T C 6: 102,265,431 M418V probably benign Het
Cpne4 T A 9: 104,686,519 C32S probably damaging Het
Csf2rb2 A T 15: 78,284,421 S845T probably benign Het
Ctnnd2 T G 15: 31,027,587 V1219G probably damaging Het
Cyp4f14 G A 17: 32,909,351 A230V probably benign Het
Cyth1 TGGGCAA T 11: 118,183,923 probably null Het
Dmxl1 T A 18: 49,961,147 C2897S probably benign Het
Elavl2 T A 4: 91,372,043 probably benign Het
Fam135a T C 1: 24,044,250 E298G probably damaging Het
Fbn1 A T 2: 125,309,485 I2534N probably damaging Het
Fibin A G 2: 110,362,480 S106P probably damaging Het
Fndc3a C T 14: 72,564,660 V568M probably benign Het
Frem2 A G 3: 53,572,374 F1966S probably damaging Het
Gata4 T G 14: 63,204,725 E216A possibly damaging Het
Gmps T A 3: 64,015,563 V649E probably benign Het
Golga4 A T 9: 118,559,311 N1834Y possibly damaging Het
Gpr89 A T 3: 96,871,490 Y422* probably null Het
Gzmc A T 14: 56,232,372 F157Y probably benign Het
Hdhd2 A G 18: 76,965,266 D204G probably damaging Het
Hspa4 T G 11: 53,280,703 T225P possibly damaging Het
Ikbkap A T 4: 56,758,968 S1191T possibly damaging Het
Klhl30 T A 1: 91,359,337 D448E probably benign Het
Kptn A G 7: 16,120,041 Y28C probably damaging Het
Krt10 A T 11: 99,387,606 N242K probably damaging Het
Krt6b A T 15: 101,678,574 N254K probably damaging Het
Lama5 G T 2: 180,201,812 D447E probably damaging Het
Lgr6 T C 1: 134,987,681 Y720C probably damaging Het
Macf1 G C 4: 123,407,599 P1037A probably benign Het
Map3k19 C T 1: 127,823,646 G656D probably benign Het
Mroh7 A C 4: 106,721,090 N130K probably benign Het
Muc16 T C 9: 18,640,505 T4831A probably benign Het
Nfkb1 A T 3: 135,585,412 L533H Het
Oaf G A 9: 43,222,780 R215C probably damaging Het
Olfr1033 G A 2: 86,041,605 V97I probably benign Het
Olfr1265 A G 2: 90,037,282 Y121C probably damaging Het
Olfr151 A G 9: 37,730,707 I92T probably damaging Het
Olfr639 C A 7: 104,012,303 R133L possibly damaging Het
Olfr971 A G 9: 39,840,322 D296G possibly damaging Het
Otub1 T C 19: 7,200,060 D74G probably damaging Het
Oxct2b A G 4: 123,116,887 E200G probably damaging Het
Pcdh1 T C 18: 38,189,609 D1057G probably benign Het
Pkd1 T A 17: 24,586,200 V3242E probably damaging Het
Pkd1l3 CCACAGGTGACATCAGAGACACCTGCATCCAGCAGCCCAACACAGGTGACATCAGAGACACCTGCATCCAGCAGCCCAACACAGGTGACATCAGACACACCTGCATCCAATAGCCCACCACAGGGGACATCAGACACACCTGGATTCAGCAGCCCAACACAGGTGACAACAGCCACACTTGTATCCAGCAGCCCACCACAGGTGACATCAGACACACCTGCATCCAGCAGCCCACCACAGGTGACATCAGACACACCTGCATCCAGCAGCCCACCACAGGTGACATCAGAGACACCTGCATCCAGCAGCCCACCACAGGTGACATCAGACACATCTGCATCCATCAGCCCACCACAGGTAATATCAGACACACCTGCATCCAGCAGCCCACCACAGGTGACATCAGAGACACCTGCATCCAGCAGCCCAACA CCACAGGTGACATCAGAGACACCTGCATCCAGCAGCCCAACACAGGTGACATCAGACACACCTGCATCCAATAGCCCACCACAGGGGACATCAGACACACCTGGATTCAGCAGCCCAACACAGGTGACAACAGCCACACTTGTATCCAGCAGCCCACCACAGGTGACATCAGACACACCTGCATCCAGCAGCCCACCACAGGTGACATCAGACACACCTGCATCCAGCAGCCCACCACAGGTGACATCAGAGACACCTGCATCCAGCAGCCCACCACAGGTGACATCAGACACATCTGCATCCATCAGCCCACCACAGGTAATATCAGACACACCTGCATCCAGCAGCCCACCACAGGTGACATCAGAGACACCTGCATCCAGCAGCCCAACA 8: 109,623,788 probably benign Het
Pla2g4e T A 2: 120,185,322 D247V probably benign Het
Pole T A 5: 110,332,548 M1995K probably benign Het
Ppargc1a T C 5: 51,548,513 E76G probably benign Het
Pten G T 19: 32,799,996 R130L probably damaging Het
Ptprj A T 2: 90,444,460 V1186D probably damaging Het
Rab4a T A 8: 123,806,137 M1K probably null Het
Rapgef3 C A 15: 97,758,390 probably null Het
Rarb C A 14: 16,548,473 V83F probably damaging Het
Rgs22 A T 15: 36,099,712 F410I probably damaging Het
Rhpn2 A C 7: 35,381,487 E459A probably benign Het
Rims4 A T 2: 163,864,054 L220Q probably damaging Het
Robo2 T C 16: 73,973,244 T531A possibly damaging Het
Sbf2 T C 7: 110,372,510 H839R probably damaging Het
Setbp1 T C 18: 78,856,853 R1200G probably benign Het
Slc12a8 C A 16: 33,624,560 P275T probably damaging Het
Slc23a1 G T 18: 35,624,501 T239N probably benign Het
Slc37a3 T A 6: 39,364,583 T40S possibly damaging Het
Speer4c T C 5: 15,710,927 probably null Het
Tet1 A T 10: 62,819,473 H1556Q possibly damaging Het
Tfcp2l1 T A 1: 118,675,595 D454E probably damaging Het
Tmem123 A T 9: 7,790,889 M64L probably benign Het
Tmem62 A T 2: 120,984,372 H172L probably benign Het
Trim15 T G 17: 36,866,872 Y77S probably benign Het
Trim37 T A 11: 87,201,444 V693E possibly damaging Het
Trim65 A G 11: 116,126,256 L460S probably damaging Het
Ttc39a T C 4: 109,422,490 V109A probably benign Het
Ttc7 A G 17: 87,292,946 M163V probably null Het
Vps13b T C 15: 35,423,232 S233P probably damaging Het
Wasl A G 6: 24,633,923 V114A possibly damaging Het
Wdr5 A G 2: 27,519,451 S62G probably damaging Het
Wfdc11 G T 2: 164,665,525 S4* probably null Het
Wfikkn2 C A 11: 94,238,984 M110I probably benign Het
Wiz T G 17: 32,357,786 E588A probably benign Het
Xylt1 A G 7: 117,656,668 H821R probably benign Het
Zbtb7c A T 18: 76,145,701 H410L probably benign Het
Zc3h18 T A 8: 122,383,971 D186E probably damaging Het
Zfp687 G T 3: 95,010,362 L700I possibly damaging Het
Zmym2 T A 14: 56,946,563 M994K probably benign Het
Other mutations in Vwf
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00489:Vwf APN 6 125658872 missense unknown
IGL00561:Vwf APN 6 125642721 missense possibly damaging 0.88
IGL01104:Vwf APN 6 125683556 missense probably damaging 1.00
IGL01404:Vwf APN 6 125677970 missense probably damaging 1.00
IGL01539:Vwf APN 6 125590262 missense possibly damaging 0.85
IGL01550:Vwf APN 6 125679289 missense probably benign 0.00
IGL01563:Vwf APN 6 125591165 missense probably damaging 1.00
IGL01637:Vwf APN 6 125645736 missense probably damaging 1.00
IGL01720:Vwf APN 6 125642835 missense possibly damaging 0.69
IGL01834:Vwf APN 6 125590170 splice site probably benign
IGL02103:Vwf APN 6 125646355 missense probably damaging 1.00
IGL02120:Vwf APN 6 125616034 missense probably benign 0.26
IGL02174:Vwf APN 6 125555395 missense probably damaging 1.00
IGL02203:Vwf APN 6 125642406 missense probably damaging 1.00
IGL02420:Vwf APN 6 125677916 missense probably benign 0.00
IGL02723:Vwf APN 6 125642930 missense possibly damaging 0.85
IGL02818:Vwf APN 6 125663548 missense probably benign
IGL02931:Vwf APN 6 125615968 missense possibly damaging 0.68
IGL03015:Vwf APN 6 125684138 splice site probably benign
IGL03038:Vwf APN 6 125604157 missense possibly damaging 0.92
IGL03060:Vwf APN 6 125663560 missense probably damaging 1.00
IGL03114:Vwf APN 6 125599363 nonsense probably null
IGL03266:Vwf APN 6 125678077 splice site probably benign
B5639:Vwf UTSW 6 125642984 missense probably damaging 1.00
R0025:Vwf UTSW 6 125682812 missense probably benign 0.05
R0025:Vwf UTSW 6 125682812 missense probably benign 0.05
R0087:Vwf UTSW 6 125645954 missense probably benign 0.03
R0194:Vwf UTSW 6 125643297 missense probably benign
R0206:Vwf UTSW 6 125637456 missense probably damaging 1.00
R0233:Vwf UTSW 6 125686510 missense possibly damaging 0.91
R0233:Vwf UTSW 6 125686510 missense possibly damaging 0.91
R0390:Vwf UTSW 6 125626361 nonsense probably null
R0427:Vwf UTSW 6 125673939 missense probably benign
R0437:Vwf UTSW 6 125566318 missense probably damaging 1.00
R0470:Vwf UTSW 6 125628428 missense possibly damaging 0.70
R0499:Vwf UTSW 6 125638114 missense probably benign 0.10
R0554:Vwf UTSW 6 125642781 missense probably benign 0.13
R0605:Vwf UTSW 6 125685837 missense probably benign 0.02
R0711:Vwf UTSW 6 125626271 missense probably benign 0.01
R0723:Vwf UTSW 6 125566262 missense probably benign 0.01
R0973:Vwf UTSW 6 125643006 missense probably damaging 1.00
R1054:Vwf UTSW 6 125590227 missense probably damaging 1.00
R1115:Vwf UTSW 6 125655065 missense unknown
R1156:Vwf UTSW 6 125637488 missense probably damaging 1.00
R1191:Vwf UTSW 6 125599252 missense probably damaging 1.00
R1240:Vwf UTSW 6 125603308 intron probably null
R1398:Vwf UTSW 6 125603457 missense probably benign 0.02
R1435:Vwf UTSW 6 125642249 nonsense probably null
R1528:Vwf UTSW 6 125608291 missense possibly damaging 0.69
R1575:Vwf UTSW 6 125655251 missense unknown
R1575:Vwf UTSW 6 125663571 nonsense probably null
R1628:Vwf UTSW 6 125647738 unclassified probably benign
R1669:Vwf UTSW 6 125647906 missense possibly damaging 0.92
R1699:Vwf UTSW 6 125643069 missense probably damaging 1.00
R1699:Vwf UTSW 6 125685900 missense possibly damaging 0.74
R1725:Vwf UTSW 6 125646282 missense probably benign 0.05
R1742:Vwf UTSW 6 125667550 missense probably benign 0.02
R1809:Vwf UTSW 6 125590175 splice site probably benign
R1833:Vwf UTSW 6 125642037 missense probably benign 0.14
R1866:Vwf UTSW 6 125667529 missense possibly damaging 0.62
R1870:Vwf UTSW 6 125642939 missense probably damaging 1.00
R1874:Vwf UTSW 6 125628372 missense probably benign 0.00
R1941:Vwf UTSW 6 125639279 missense possibly damaging 0.64
R2061:Vwf UTSW 6 125591188 missense probably damaging 0.98
R2103:Vwf UTSW 6 125646330 missense probably benign 0.31
R2104:Vwf UTSW 6 125646330 missense probably benign 0.31
R2130:Vwf UTSW 6 125657057 missense probably damaging 1.00
R2159:Vwf UTSW 6 125626341 missense probably damaging 0.99
R2178:Vwf UTSW 6 125642132 missense possibly damaging 0.90
R2656:Vwf UTSW 6 125555361 missense probably benign 0.00
R2913:Vwf UTSW 6 125685846 missense probably benign 0.08
R2917:Vwf UTSW 6 125608143 missense probably benign 0.07
R3726:Vwf UTSW 6 125677948 utr 3 prime probably benign
R3735:Vwf UTSW 6 125588613 missense probably damaging 1.00
R3774:Vwf UTSW 6 125649099 intron probably null
R3934:Vwf UTSW 6 125555499 missense probably damaging 1.00
R4291:Vwf UTSW 6 125642322 missense probably damaging 1.00
R4384:Vwf UTSW 6 125655116 missense unknown
R4743:Vwf UTSW 6 125684091 critical splice acceptor site probably null
R4760:Vwf UTSW 6 125570604 missense probably damaging 1.00
R4776:Vwf UTSW 6 125566305 missense possibly damaging 0.53
R4791:Vwf UTSW 6 125643363 missense
R4871:Vwf UTSW 6 125686462 missense probably benign 0.25
R4894:Vwf UTSW 6 125645934 nonsense probably null
R4963:Vwf UTSW 6 125667483 nonsense probably null
R5010:Vwf UTSW 6 125566257 missense probably benign 0.15
R5289:Vwf UTSW 6 125667510 utr 3 prime probably benign
R5512:Vwf UTSW 6 125673887 utr 3 prime probably benign
R5523:Vwf UTSW 6 125643042 missense
R5642:Vwf UTSW 6 125603418 missense
R5860:Vwf UTSW 6 125643090 missense
R5860:Vwf UTSW 6 125679265 utr 3 prime probably benign
R5896:Vwf UTSW 6 125678762 critical splice acceptor site probably null
R5926:Vwf UTSW 6 125604174 missense probably damaging 1.00
R5976:Vwf UTSW 6 125603463 missense
R6053:Vwf UTSW 6 125600665 missense probably benign 0.21
R6151:Vwf UTSW 6 125657065 missense unknown
R6179:Vwf UTSW 6 125649289 missense unknown
R6181:Vwf UTSW 6 125566146 missense probably damaging 0.98
R6234:Vwf UTSW 6 125657165 missense unknown
R6360:Vwf UTSW 6 125683526 missense probably benign 0.13
R6412:Vwf UTSW 6 125679316 missense probably benign 0.00
R6464:Vwf UTSW 6 125639400 critical splice donor site probably null
R6522:Vwf UTSW 6 125662963 critical splice acceptor site probably null
R6766:Vwf UTSW 6 125639376 missense unknown
R6856:Vwf UTSW 6 125642150 nonsense probably null
R6877:Vwf UTSW 6 125657201 missense possibly damaging 0.48
R6896:Vwf UTSW 6 125566194 missense probably damaging 1.00
R7113:Vwf UTSW 6 125655044 missense
R7287:Vwf UTSW 6 125637467 missense
R7359:Vwf UTSW 6 125566257 missense
R7509:Vwf UTSW 6 125642169 missense
R7519:Vwf UTSW 6 125667543 missense
R7545:Vwf UTSW 6 125614097 missense
R7549:Vwf UTSW 6 125626267 missense
R7593:Vwf UTSW 6 125647768 missense
R7635:Vwf UTSW 6 125682734 missense
R7793:Vwf UTSW 6 125686520 missense
R7802:Vwf UTSW 6 125666677 missense
R7824:Vwf UTSW 6 125658815 missense
R7900:Vwf UTSW 6 125628476 critical splice donor site probably null
R7932:Vwf UTSW 6 125656803 missense
R7983:Vwf UTSW 6 125628476 critical splice donor site probably null
R8101:Vwf UTSW 6 125570559 nonsense probably null
X0021:Vwf UTSW 6 125646331 missense probably damaging 1.00
X0065:Vwf UTSW 6 125603433 missense probably null 0.05
Z1176:Vwf UTSW 6 125591231 missense
Z1176:Vwf UTSW 6 125603308 intron probably null
Predicted Primers PCR Primer
(F):5'- TCTTGTCTGAGCAGATGGC -3'
(R):5'- CAGATTCCTGGAGCAGCAAC -3'

Sequencing Primer
(F):5'- CAGTGGATGGGAGACTGGTCC -3'
(R):5'- TTCCTGGAGCAGCAACAACAAAAAG -3'
Posted On2019-12-20