Mutagenetix > Incidental Mutation

Incidental Mutation 'R0165:Tnrc6b'

60682

Institutional Source

Beutler Lab

Gene Symbol

Tnrc6b

Ensembl Gene

ENSMUSG00000047888

Gene Name

trinucleotide repeat containing 6b

Synonyms

MMRRC Submission

038441-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.185) question?

Stock #

R0165 (G1)

Quality Score

147

Status

Validated

Chromosome

Chromosomal Location

80711313-80941085 bp(+) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

T to A at 80858670 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000064336 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000067689]

AlphaFold

Q8BKI2

Predicted Effect

probably null
Transcript: ENSMUST00000067689

SMART Domains

Protein: ENSMUSP00000064336
Gene: ENSMUSG00000047888

Domain	Start	End	E-Value	Type
low complexity region	7	19	N/A	INTRINSIC
coiled coil region	33	72	N/A	INTRINSIC
low complexity region	88	106	N/A	INTRINSIC
low complexity region	155	174	N/A	INTRINSIC
low complexity region	207	220	N/A	INTRINSIC
low complexity region	242	260	N/A	INTRINSIC
low complexity region	331	346	N/A	INTRINSIC
low complexity region	363	380	N/A	INTRINSIC
low complexity region	416	425	N/A	INTRINSIC
low complexity region	475	487	N/A	INTRINSIC
internal_repeat_1	488	667	6.43e-5	PROSPERO
low complexity region	858	888	N/A	INTRINSIC
Pfam:Ago_hook	955	1095	1.2e-28	PFAM
coiled coil region	1258	1307	N/A	INTRINSIC
Pfam:TNRC6-PABC_bdg	1339	1623	2.8e-112	PFAM
Pfam:RRM_5	1641	1695	2e-7	PFAM
low complexity region	1705	1721	N/A	INTRINSIC
low complexity region	1748	1769	N/A	INTRINSIC
low complexity region	1792	1809	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000226857

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000228071

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 99.4%
3x: 98.5%
10x: 96.2%
20x: 91.4%

Validation Efficiency

96% (81/84)

MGI Phenotype

PHENOTYPE: Mice homozygous for a gene trap allele exhibit neonatal and postnatal lethality with decreased body weight and infertility. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 73 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2410089E03Rik	G	A	15: 8,216,382	V1413M	probably damaging	Het
2700049A03Rik	T	C	12: 71,167,150	I717T	possibly damaging	Het
3632451O06Rik	A	G	14: 49,773,786	S155P	probably benign	Het
6430571L13Rik	A	G	9: 107,346,184		probably benign	Het
Abca15	T	A	7: 120,350,903		probably benign	Het
Abca6	A	G	11: 110,219,604	V573A	possibly damaging	Het
Adgrl2	A	G	3: 148,852,863		probably benign	Het
Agap3	A	G	5: 24,479,745	T544A	probably damaging	Het
Ahrr	G	A	13: 74,283,024		probably benign	Het
Akr1c20	T	C	13: 4,523,296	T7A	probably benign	Het
Ankrd26	A	G	6: 118,540,484	S459P	probably benign	Het
Ascc3	T	A	10: 50,842,127		probably null	Het
Brd1	T	C	15: 88,729,777	N305S	probably damaging	Het
Catip	T	A	1: 74,368,469	L320Q	possibly damaging	Het
Cttnbp2	G	A	6: 18,435,410	Q150*	probably null	Het
Cyp2d22	T	G	15: 82,373,280	N228T	probably benign	Het
Dapk1	T	C	13: 60,761,593	V1340A	probably benign	Het
Dcaf4	G	A	12: 83,535,988		probably benign	Het
Ddhd1	G	A	14: 45,595,592	T849M	probably damaging	Het
Dnah6	A	G	6: 73,021,323	S3987P	probably benign	Het
Dst	C	A	1: 34,154,646		probably benign	Het
Epha2	T	C	4: 141,321,892		probably null	Het
Ern2	T	C	7: 122,179,779	T281A	probably benign	Het
Extl1	A	G	4: 134,357,703	F652S	probably damaging	Het
Gckr	A	G	5: 31,326,948	S541G	possibly damaging	Het
Gdap1l1	A	G	2: 163,451,499		probably null	Het
Gm7535	T	C	17: 17,911,175		probably benign	Het
Gmps	T	A	3: 63,993,954	I398N	probably damaging	Het
Igf2r	A	G	17: 12,698,527	V1556A	probably benign	Het
Il3ra	T	A	14: 14,350,967	N283K	probably benign	Het
Ist1	A	G	8: 109,675,366		probably benign	Het
Lama3	A	T	18: 12,524,810	I1934F	probably damaging	Het
Lars	A	T	18: 42,202,697	M1118K	possibly damaging	Het
Lpin2	C	T	17: 71,246,519	S846L	probably damaging	Het
Lrrc4b	C	A	7: 44,462,315	T537K	probably damaging	Het
Ltn1	G	A	16: 87,405,519		probably benign	Het
Meiob	A	G	17: 24,835,161	T401A	probably benign	Het
Mettl21e	G	A	1: 44,211,123	T41M	probably damaging	Het
Miga1	C	T	3: 152,290,843	E323K	probably damaging	Het
Ndufs1	A	T	1: 63,159,748		probably null	Het
Olfr486	T	C	7: 108,172,675	D23G	probably benign	Het
Otog	G	A	7: 46,304,231	V2638M	probably damaging	Het
Parp6	T	C	9: 59,632,925	Y274H	probably damaging	Het
Prom2	A	T	2: 127,539,514		probably benign	Het
Prune2	T	A	19: 17,122,610	M1826K	probably benign	Het
Qk	T	A	17: 10,238,963	D159V	probably damaging	Het
Rab12	A	T	17: 66,500,317	I139N	probably damaging	Het
Rab25	T	A	3: 88,548,055	E7D	probably benign	Het
Rala	A	T	13: 17,888,589	V139E	probably benign	Het
Ralgapa2	A	G	2: 146,388,487		probably benign	Het
Rbl2	T	A	8: 91,074,176	Y89N	probably damaging	Het
Rho	A	T	6: 115,932,227	I75F	probably damaging	Het
Slc38a4	C	A	15: 97,008,949	A303S	probably benign	Het
Slc6a15	A	G	10: 103,409,809	D551G	probably null	Het
Smyd3	T	C	1: 179,043,872	N314S	probably benign	Het
Speer4f1	T	A	5: 17,479,514	L180*	probably null	Het
Stat6	T	C	10: 127,657,227	V576A	probably damaging	Het
Strn	T	C	17: 78,677,374	D127G	possibly damaging	Het
Syne1	T	C	10: 5,033,096	R8610G	probably benign	Het
Tbc1d7	A	C	13: 43,153,202		probably null	Het
Tcf3	C	T	10: 80,412,997	R548Q	probably damaging	Het
Tlr9	C	A	9: 106,226,087	A859D	probably benign	Het
Tmem106c	T	A	15: 97,968,139		probably benign	Het
Tmprss11c	A	T	5: 86,231,927		probably benign	Het
Tnfsf18	A	G	1: 161,494,731	R7G	probably benign	Het
Trpm7	A	T	2: 126,797,513	F1684I	probably damaging	Het
Ttbk1	C	A	17: 46,478,938	R133L	possibly damaging	Het
Ttn	A	G	2: 76,721,342	S22962P	probably damaging	Het
Ube2q1	T	A	3: 89,776,153	L135Q	probably damaging	Het
Vmn1r28	G	A	6: 58,265,717	A182T	probably benign	Het
Vwce	T	C	19: 10,659,973		probably benign	Het
Wdhd1	A	G	14: 47,267,068	S350P	probably benign	Het
Zbtb21	A	G	16: 97,951,404	S560P	probably damaging	Het

Other mutations in Tnrc6b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01312:Tnrc6b	APN	15	80923578	missense	probably damaging	1.00
IGL01402:Tnrc6b	APN	15	80880544	missense	possibly damaging	0.71
IGL01505:Tnrc6b	APN	15	80879963	missense	probably benign	0.00
IGL01516:Tnrc6b	APN	15	80902622	missense	possibly damaging	0.93
IGL01584:Tnrc6b	APN	15	80879682	missense	probably benign	0.01
IGL01681:Tnrc6b	APN	15	80879311	splice site	probably null
IGL01909:Tnrc6b	APN	15	80901983	missense	possibly damaging	0.88
IGL01943:Tnrc6b	APN	15	80927695	nonsense	probably null
IGL02253:Tnrc6b	APN	15	80876541	missense	probably damaging	0.99
IGL02260:Tnrc6b	APN	15	80880171	missense	probably damaging	0.99
IGL02437:Tnrc6b	APN	15	80880457	missense	probably damaging	1.00
IGL02541:Tnrc6b	APN	15	80879831	missense	probably benign	0.00
IGL02542:Tnrc6b	APN	15	80902352	missense	possibly damaging	0.83
grosser	UTSW	15	80929285	missense	probably damaging	1.00
heiliger	UTSW	15	80927741	critical splice donor site	probably null
PIT1430001:Tnrc6b	UTSW	15	80929186	missense	probably damaging	0.99
R0092:Tnrc6b	UTSW	15	80918528	missense	probably damaging	1.00
R0238:Tnrc6b	UTSW	15	80887864	missense	probably damaging	1.00
R0238:Tnrc6b	UTSW	15	80887864	missense	probably damaging	1.00
R0257:Tnrc6b	UTSW	15	80894355	missense	possibly damaging	0.80
R0418:Tnrc6b	UTSW	15	80913323	missense	probably benign	0.27
R0432:Tnrc6b	UTSW	15	80923446	splice site	probably benign
R0487:Tnrc6b	UTSW	15	80880675	missense	probably benign	0.01
R0498:Tnrc6b	UTSW	15	80858719	missense	probably damaging	0.98
R0528:Tnrc6b	UTSW	15	80879403	missense	probably benign	0.00
R0533:Tnrc6b	UTSW	15	80876653	missense	probably benign	0.00
R0571:Tnrc6b	UTSW	15	80913338	missense	probably damaging	1.00
R0650:Tnrc6b	UTSW	15	80784758	missense	probably benign	0.33
R0659:Tnrc6b	UTSW	15	80923446	splice site	probably benign
R0884:Tnrc6b	UTSW	15	80902555	small deletion	probably benign
R1131:Tnrc6b	UTSW	15	80894453	missense	possibly damaging	0.45
R1188:Tnrc6b	UTSW	15	80879229	missense	probably benign
R1479:Tnrc6b	UTSW	15	80887032	splice site	probably null
R1564:Tnrc6b	UTSW	15	80880168	missense	possibly damaging	0.95
R1645:Tnrc6b	UTSW	15	80882958	missense	probably damaging	0.99
R1924:Tnrc6b	UTSW	15	80884206	critical splice acceptor site	probably null
R1926:Tnrc6b	UTSW	15	80881162	missense	probably damaging	1.00
R1928:Tnrc6b	UTSW	15	80880723	missense	probably damaging	1.00
R1965:Tnrc6b	UTSW	15	80880439	missense	probably damaging	1.00
R1966:Tnrc6b	UTSW	15	80880439	missense	probably damaging	1.00
R2072:Tnrc6b	UTSW	15	80882965	missense	possibly damaging	0.89
R3084:Tnrc6b	UTSW	15	80880247	missense	probably damaging	1.00
R3552:Tnrc6b	UTSW	15	80880247	missense	probably damaging	1.00
R3736:Tnrc6b	UTSW	15	80889163	splice site	probably benign
R3791:Tnrc6b	UTSW	15	80923640	missense	probably damaging	1.00
R4170:Tnrc6b	UTSW	15	80916787	missense	probably benign	0.24
R4276:Tnrc6b	UTSW	15	80901971	missense	probably benign	0.42
R4519:Tnrc6b	UTSW	15	80880247	missense	probably damaging	1.00
R5380:Tnrc6b	UTSW	15	80879565	missense	possibly damaging	0.56
R5470:Tnrc6b	UTSW	15	80916711	missense	possibly damaging	0.89
R5590:Tnrc6b	UTSW	15	80876502	missense	probably damaging	0.98
R5982:Tnrc6b	UTSW	15	80880816	missense	probably benign
R6269:Tnrc6b	UTSW	15	80880743	missense	probably benign	0.42
R6331:Tnrc6b	UTSW	15	80879614	missense	probably benign	0.00
R6484:Tnrc6b	UTSW	15	80879324	missense	possibly damaging	0.92
R6622:Tnrc6b	UTSW	15	80879184	missense	probably damaging	0.99
R6695:Tnrc6b	UTSW	15	80879773	missense	probably damaging	1.00
R6728:Tnrc6b	UTSW	15	80918526	missense	probably damaging	1.00
R6776:Tnrc6b	UTSW	15	80924119	missense	possibly damaging	0.87
R7159:Tnrc6b	UTSW	15	80887022	missense	possibly damaging	0.92
R7210:Tnrc6b	UTSW	15	80929285	missense	probably damaging	1.00
R7287:Tnrc6b	UTSW	15	80879541	missense	possibly damaging	0.83
R7402:Tnrc6b	UTSW	15	80884300	missense	probably damaging	1.00
R7479:Tnrc6b	UTSW	15	80889126	missense	probably benign	0.13
R7533:Tnrc6b	UTSW	15	80927741	critical splice donor site	probably null
R7571:Tnrc6b	UTSW	15	80929393	missense	probably benign
R7594:Tnrc6b	UTSW	15	80880307	missense	possibly damaging	0.66
R7831:Tnrc6b	UTSW	15	80880379	missense	possibly damaging	0.49
R8208:Tnrc6b	UTSW	15	80858700	missense	possibly damaging	0.53
R8276:Tnrc6b	UTSW	15	80880717	missense	probably benign	0.00
R8295:Tnrc6b	UTSW	15	80913364	missense	probably damaging	1.00
R8351:Tnrc6b	UTSW	15	80923490	missense	probably damaging	0.99
R8423:Tnrc6b	UTSW	15	80929418	missense	unknown
R8451:Tnrc6b	UTSW	15	80923490	missense	probably damaging	0.99
R8725:Tnrc6b	UTSW	15	80876452	missense	probably damaging	1.00
R8872:Tnrc6b	UTSW	15	80918089	missense	probably benign	0.23
R9029:Tnrc6b	UTSW	15	80878978	missense	possibly damaging	0.83
R9057:Tnrc6b	UTSW	15	80879148	missense	probably benign
R9240:Tnrc6b	UTSW	15	80880061	missense	probably damaging	0.98
R9450:Tnrc6b	UTSW	15	80880436	missense	probably benign	0.01
R9539:Tnrc6b	UTSW	15	80876343	missense	probably damaging	0.99
R9646:Tnrc6b	UTSW	15	80889065	missense	possibly damaging	0.89
X0020:Tnrc6b	UTSW	15	80882997	missense	probably benign	0.16
X0025:Tnrc6b	UTSW	15	80881167	missense	probably benign	0.03
Z1088:Tnrc6b	UTSW	15	80927690	nonsense	probably null
Z1177:Tnrc6b	UTSW	15	80858699	missense	possibly damaging	0.68

Predicted Primers

PCR Primer
(F):5'- GGCATCTTTGAAACCAAGCCTATGTG -3'
(R):5'- ACTAGAACCTGTCTGAGGGCAGTTAC -3'

Sequencing Primer
(F):5'- GCCTATGTGTGAATAGTTTGTGAAAG -3'
(R):5'- ACTAATGAATGCCTCAGGTGTG -3'

Posted On

2013-07-24