Incidental Mutation 'R7849:Wfikkn2'
ID606827
Institutional Source Beutler Lab
Gene Symbol Wfikkn2
Ensembl Gene ENSMUSG00000044177
Gene NameWAP, follistatin/kazal, immunoglobulin, kunitz and netrin domain containing 2
Synonyms2610304F08Rik, Gasp1
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7849 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location94235956-94246005 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 94238984 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Isoleucine at position 110 (M110I)
Ref Sequence ENSEMBL: ENSMUSP00000053238 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061469]
Predicted Effect probably benign
Transcript: ENSMUST00000061469
AA Change: M110I

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000053238
Gene: ENSMUSG00000044177
AA Change: M110I

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
WAP 37 87 1.77e-3 SMART
low complexity region 91 102 N/A INTRINSIC
KAZAL 128 170 1.5e-2 SMART
low complexity region 179 192 N/A INTRINSIC
IGc2 217 289 1.3e-11 SMART
KU 321 374 2e-14 SMART
KU 379 432 2.79e-27 SMART
Pfam:NTR 451 556 2.1e-13 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The WFIKKN1 protein contains a WAP domain, follistatin domain, immunoglobulin domain, two tandem Kunitz domains, and an NTR domain. This gene encodes a WFIKKN1-related protein which has the same domain organization as the WFIKKN1 protein. The WAP-type, follistatin type, Kunitz-type, and NTR-type protease inhibitory domains may control the action of multiple types of proteases. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null mutation show impaired muscle regeneration and a mild decrease in skeletal muscle weight in males. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 94 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik T A 3: 37,026,328 I325N Het
Agap1 T C 1: 89,630,419 V143A probably damaging Het
Agmo A G 12: 37,242,045 R2G probably benign Het
Alms1 A T 6: 85,621,497 I1102L possibly damaging Het
Ankrd13a T C 5: 114,791,282 I140T possibly damaging Het
Arhgef10l T A 4: 140,583,934 probably null Het
Atxn2l A T 7: 126,493,173 H967Q possibly damaging Het
B3galnt2 A T 13: 13,994,492 N370I probably benign Het
BC053393 T A 11: 46,577,231 I44K not run Het
Cacna1e C T 1: 154,633,718 D264N probably damaging Het
Ccdc112 A T 18: 46,296,323 Y103N probably benign Het
Ccdc68 A C 18: 69,947,175 E197A probably damaging Het
Cdr1 AAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCC AAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCC X: 61,184,524 probably benign Het
Cntn3 T C 6: 102,265,431 M418V probably benign Het
Cpne4 T A 9: 104,686,519 C32S probably damaging Het
Csf2rb2 A T 15: 78,284,421 S845T probably benign Het
Ctnnd2 T G 15: 31,027,587 V1219G probably damaging Het
Cyp4f14 G A 17: 32,909,351 A230V probably benign Het
Cyth1 TGGGCAA T 11: 118,183,923 probably null Het
Dmxl1 T A 18: 49,961,147 C2897S probably benign Het
Elavl2 T A 4: 91,372,043 probably benign Het
Fam135a T C 1: 24,044,250 E298G probably damaging Het
Fbn1 A T 2: 125,309,485 I2534N probably damaging Het
Fibin A G 2: 110,362,480 S106P probably damaging Het
Fndc3a C T 14: 72,564,660 V568M probably benign Het
Frem2 A G 3: 53,572,374 F1966S probably damaging Het
Gata4 T G 14: 63,204,725 E216A possibly damaging Het
Gmps T A 3: 64,015,563 V649E probably benign Het
Golga4 A T 9: 118,559,311 N1834Y possibly damaging Het
Gpr89 A T 3: 96,871,490 Y422* probably null Het
Gzmc A T 14: 56,232,372 F157Y probably benign Het
Hdhd2 A G 18: 76,965,266 D204G probably damaging Het
Hspa4 T G 11: 53,280,703 T225P possibly damaging Het
Ikbkap A T 4: 56,758,968 S1191T possibly damaging Het
Klhl30 T A 1: 91,359,337 D448E probably benign Het
Kptn A G 7: 16,120,041 Y28C probably damaging Het
Krt10 A T 11: 99,387,606 N242K probably damaging Het
Krt6b A T 15: 101,678,574 N254K probably damaging Het
Lama5 G T 2: 180,201,812 D447E probably damaging Het
Lgr6 T C 1: 134,987,681 Y720C probably damaging Het
Macf1 G C 4: 123,407,599 P1037A probably benign Het
Map3k19 C T 1: 127,823,646 G656D probably benign Het
Mroh7 A C 4: 106,721,090 N130K probably benign Het
Muc16 T C 9: 18,640,505 T4831A probably benign Het
Nfkb1 A T 3: 135,585,412 L533H Het
Oaf G A 9: 43,222,780 R215C probably damaging Het
Olfr1033 G A 2: 86,041,605 V97I probably benign Het
Olfr1265 A G 2: 90,037,282 Y121C probably damaging Het
Olfr151 A G 9: 37,730,707 I92T probably damaging Het
Olfr639 C A 7: 104,012,303 R133L possibly damaging Het
Olfr971 A G 9: 39,840,322 D296G possibly damaging Het
Otub1 T C 19: 7,200,060 D74G probably damaging Het
Oxct2b A G 4: 123,116,887 E200G probably damaging Het
Pcdh1 T C 18: 38,189,609 D1057G probably benign Het
Pkd1 T A 17: 24,586,200 V3242E probably damaging Het
Pkd1l3 CCACAGGTGACATCAGAGACACCTGCATCCAGCAGCCCAACACAGGTGACATCAGAGACACCTGCATCCAGCAGCCCAACACAGGTGACATCAGACACACCTGCATCCAATAGCCCACCACAGGGGACATCAGACACACCTGGATTCAGCAGCCCAACACAGGTGACAACAGCCACACTTGTATCCAGCAGCCCACCACAGGTGACATCAGACACACCTGCATCCAGCAGCCCACCACAGGTGACATCAGACACACCTGCATCCAGCAGCCCACCACAGGTGACATCAGAGACACCTGCATCCAGCAGCCCACCACAGGTGACATCAGACACATCTGCATCCATCAGCCCACCACAGGTAATATCAGACACACCTGCATCCAGCAGCCCACCACAGGTGACATCAGAGACACCTGCATCCAGCAGCCCAACA CCACAGGTGACATCAGAGACACCTGCATCCAGCAGCCCAACACAGGTGACATCAGACACACCTGCATCCAATAGCCCACCACAGGGGACATCAGACACACCTGGATTCAGCAGCCCAACACAGGTGACAACAGCCACACTTGTATCCAGCAGCCCACCACAGGTGACATCAGACACACCTGCATCCAGCAGCCCACCACAGGTGACATCAGACACACCTGCATCCAGCAGCCCACCACAGGTGACATCAGAGACACCTGCATCCAGCAGCCCACCACAGGTGACATCAGACACATCTGCATCCATCAGCCCACCACAGGTAATATCAGACACACCTGCATCCAGCAGCCCACCACAGGTGACATCAGAGACACCTGCATCCAGCAGCCCAACA 8: 109,623,788 probably benign Het
Pla2g4e T A 2: 120,185,322 D247V probably benign Het
Pole T A 5: 110,332,548 M1995K probably benign Het
Ppargc1a T C 5: 51,548,513 E76G probably benign Het
Pten G T 19: 32,799,996 R130L probably damaging Het
Ptprj A T 2: 90,444,460 V1186D probably damaging Het
Rab4a T A 8: 123,806,137 M1K probably null Het
Rapgef3 C A 15: 97,758,390 probably null Het
Rarb C A 14: 16,548,473 V83F probably damaging Het
Rgs22 A T 15: 36,099,712 F410I probably damaging Het
Rhpn2 A C 7: 35,381,487 E459A probably benign Het
Rims4 A T 2: 163,864,054 L220Q probably damaging Het
Robo2 T C 16: 73,973,244 T531A possibly damaging Het
Sbf2 T C 7: 110,372,510 H839R probably damaging Het
Setbp1 T C 18: 78,856,853 R1200G probably benign Het
Slc12a8 C A 16: 33,624,560 P275T probably damaging Het
Slc23a1 G T 18: 35,624,501 T239N probably benign Het
Slc37a3 T A 6: 39,364,583 T40S possibly damaging Het
Speer4c T C 5: 15,710,927 probably null Het
Tet1 A T 10: 62,819,473 H1556Q possibly damaging Het
Tfcp2l1 T A 1: 118,675,595 D454E probably damaging Het
Tmem123 A T 9: 7,790,889 M64L probably benign Het
Tmem62 A T 2: 120,984,372 H172L probably benign Het
Trim15 T G 17: 36,866,872 Y77S probably benign Het
Trim37 T A 11: 87,201,444 V693E possibly damaging Het
Trim65 A G 11: 116,126,256 L460S probably damaging Het
Ttc39a T C 4: 109,422,490 V109A probably benign Het
Ttc7 A G 17: 87,292,946 M163V probably null Het
Vps13b T C 15: 35,423,232 S233P probably damaging Het
Vwf T C 6: 125,656,803 L2084P Het
Wasl A G 6: 24,633,923 V114A possibly damaging Het
Wdr5 A G 2: 27,519,451 S62G probably damaging Het
Wfdc11 G T 2: 164,665,525 S4* probably null Het
Wiz T G 17: 32,357,786 E588A probably benign Het
Xylt1 A G 7: 117,656,668 H821R probably benign Het
Zbtb7c A T 18: 76,145,701 H410L probably benign Het
Zc3h18 T A 8: 122,383,971 D186E probably damaging Het
Zfp687 G T 3: 95,010,362 L700I possibly damaging Het
Zmym2 T A 14: 56,946,563 M994K probably benign Het
Other mutations in Wfikkn2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00816:Wfikkn2 APN 11 94238095 nonsense probably null
R1269:Wfikkn2 UTSW 11 94238475 missense probably damaging 1.00
R1466:Wfikkn2 UTSW 11 94238895 missense probably damaging 1.00
R1466:Wfikkn2 UTSW 11 94238895 missense probably damaging 1.00
R1519:Wfikkn2 UTSW 11 94238107 missense probably benign 0.00
R1584:Wfikkn2 UTSW 11 94238895 missense probably damaging 1.00
R1856:Wfikkn2 UTSW 11 94238123 nonsense probably null
R2026:Wfikkn2 UTSW 11 94238953 missense possibly damaging 0.93
R2842:Wfikkn2 UTSW 11 94238259 missense probably benign 0.00
R4738:Wfikkn2 UTSW 11 94239076 missense probably benign 0.00
R4833:Wfikkn2 UTSW 11 94239052 missense probably benign 0.09
R5087:Wfikkn2 UTSW 11 94238347 missense probably damaging 1.00
R5775:Wfikkn2 UTSW 11 94238288 missense probably benign 0.22
R5966:Wfikkn2 UTSW 11 94238862 missense probably damaging 1.00
R6842:Wfikkn2 UTSW 11 94238040 missense probably damaging 0.96
R7539:Wfikkn2 UTSW 11 94242359 missense probably damaging 1.00
R7544:Wfikkn2 UTSW 11 94237912 missense probably benign 0.09
R7879:Wfikkn2 UTSW 11 94238929 missense probably damaging 1.00
R8299:Wfikkn2 UTSW 11 94239064 missense probably damaging 1.00
Z1176:Wfikkn2 UTSW 11 94237652 missense possibly damaging 0.62
Z1176:Wfikkn2 UTSW 11 94238401 missense not run
Predicted Primers PCR Primer
(F):5'- ACAGTGTGATGCCCTTGGAG -3'
(R):5'- CAGGATCCTGACCAACAGTAAG -3'

Sequencing Primer
(F):5'- ATGCCCTTGGAGCAGGCTTC -3'
(R):5'- GTGAGTTCTTATCTACATTCAGTGC -3'
Posted On2019-12-20