Incidental Mutation 'R7850:Pi15'
ID606862
Institutional Source Beutler Lab
Gene Symbol Pi15
Ensembl Gene ENSMUSG00000067780
Gene Namepeptidase inhibitor 15
SynonymsP25TI, SugarCrisp, P24TI
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7850 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location17601901-17630939 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 17602881 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 101 (Y101*)
Ref Sequence ENSEMBL: ENSMUSP00000085826 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000088476]
Predicted Effect probably null
Transcript: ENSMUST00000088476
AA Change: Y101*
SMART Domains Protein: ENSMUSP00000085826
Gene: ENSMUSG00000067780
AA Change: Y101*

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
SCP 76 230 9.32e-37 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a trypsin inhibitor. The protein shares similarity to insect venom allergens, mammalian testis-specific proteins and plant pathogenesis-related proteins. It is frequently expressed in human neuroblastoma and glioblastoma cell lines, and thus may play a role in the central nervous system. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A630089N07Rik A T 16: 98,068,128 D2E probably damaging Het
Abhd16b G A 2: 181,493,725 R140H not run Het
Acad11 G T 9: 104,114,529 G588C probably damaging Het
Baz2b C A 2: 59,936,716 E107D probably damaging Het
Bcas1 A G 2: 170,348,103 S625P probably damaging Het
Bdp1 T A 13: 100,092,324 L265F probably damaging Het
Cacna1s A G 1: 136,071,048 Y227C probably damaging Het
Cacna2d2 G A 9: 107,525,376 A848T probably benign Het
Cep135 T C 5: 76,591,873 probably null Het
Cyp2b9 G T 7: 26,186,686 E93* probably null Het
Dcp2 C A 18: 44,400,348 S122* probably null Het
Ecel1 A G 1: 87,152,023 L456P probably damaging Het
Entpd8 T C 2: 25,085,016 M453T probably damaging Het
Gcc2 T A 10: 58,278,881 V1084D probably damaging Het
Grem1 A G 2: 113,749,833 C108R probably damaging Het
Gtf2ird1 T C 5: 134,363,215 E880G probably benign Het
Hacd2 T A 16: 35,102,107 M222K probably damaging Het
Ifnab T G 4: 88,690,896 D111A probably benign Het
Igsf10 A T 3: 59,319,632 L2207I probably benign Het
Itln1 T C 1: 171,530,598 Y194C probably damaging Het
Kmt5b T A 19: 3,815,043 D702E probably damaging Het
Knop1 T C 7: 118,850,637 E382G unknown Het
Lrit3 A C 3: 129,800,803 L42V probably damaging Het
Mug2 A G 6: 122,075,211 E976G probably damaging Het
Olfr1436 T C 19: 12,298,632 M167V probably benign Het
Olfr281 G A 15: 98,457,068 G253R probably damaging Het
Olfr945 A T 9: 39,258,222 I150N possibly damaging Het
Papln A T 12: 83,780,662 E758V probably damaging Het
Pcnx3 A C 19: 5,678,932 F967V possibly damaging Het
Pcnx4 G T 12: 72,556,068 C368F probably benign Het
Ppp1r9a G A 6: 4,905,894 V150M possibly damaging Het
Prrt4 A T 6: 29,176,901 probably null Het
Ptgdr A G 14: 44,853,371 V310A probably benign Het
Ric1 G A 19: 29,594,893 S696N probably benign Het
Setx T A 2: 29,147,418 V1305D probably damaging Het
Slk G A 19: 47,622,357 R822H probably damaging Het
Tas2r135 T A 6: 42,406,138 F204I probably benign Het
Tmtc2 A G 10: 105,573,707 Y15H probably benign Het
Treml2 T C 17: 48,308,140 S218P probably benign Het
Tubb2a T C 13: 34,074,571 E412G probably damaging Het
Vmn2r25 A T 6: 123,828,472 N475K probably damaging Het
Zscan4-ps1 G A 7: 11,065,808 H385Y probably benign Het
Other mutations in Pi15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00839:Pi15 APN 1 17621523 missense probably damaging 1.00
IGL00844:Pi15 APN 1 17621540 splice site probably benign
IGL03388:Pi15 APN 1 17602777 missense probably benign
R0554:Pi15 UTSW 1 17621648 missense probably benign 0.06
R0578:Pi15 UTSW 1 17602849 nonsense probably null
R1524:Pi15 UTSW 1 17619852 missense probably benign 0.01
R1665:Pi15 UTSW 1 17621502 missense probably damaging 1.00
R1791:Pi15 UTSW 1 17602721 missense probably benign 0.02
R4767:Pi15 UTSW 1 17602766 missense probably benign
R7804:Pi15 UTSW 1 17624913 nonsense probably null
R7933:Pi15 UTSW 1 17602881 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CTGCCAGCCAATAACTTCACTG -3'
(R):5'- ATGTGGTTATGGAACTCACAGAAG -3'

Sequencing Primer
(F):5'- TTCACTGATACTGAAGCCGC -3'
(R):5'- AATCTATATAGATCCACCTGTCCTG -3'
Posted On2019-12-20