Incidental Mutation 'R7850:Mug2'
ID606880
Institutional Source Beutler Lab
Gene Symbol Mug2
Ensembl Gene ENSMUSG00000030131
Gene Namemurinoglobulin 2
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.053) question?
Stock #R7850 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location122006761-122085965 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 122075211 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 976 (E976G)
Ref Sequence ENSEMBL: ENSMUSP00000080469 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081777]
Predicted Effect probably damaging
Transcript: ENSMUST00000081777
AA Change: E976G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000080469
Gene: ENSMUSG00000030131
AA Change: E976G

DomainStartEndE-ValueType
Pfam:A2M_N 128 221 3.5e-21 PFAM
A2M_N_2 449 599 1.05e-42 SMART
low complexity region 711 728 N/A INTRINSIC
A2M 740 830 7.16e-36 SMART
Pfam:Thiol-ester_cl 963 992 1e-18 PFAM
low complexity region 994 1005 N/A INTRINSIC
Pfam:A2M_comp 1012 1097 5.8e-34 PFAM
Pfam:A2M_comp 1093 1243 3e-47 PFAM
A2M_recep 1353 1440 1.85e-38 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (43/43)
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A630089N07Rik A T 16: 98,068,128 D2E probably damaging Het
Abhd16b G A 2: 181,493,725 R140H not run Het
Acad11 G T 9: 104,114,529 G588C probably damaging Het
Baz2b C A 2: 59,936,716 E107D probably damaging Het
Bcas1 A G 2: 170,348,103 S625P probably damaging Het
Bdp1 T A 13: 100,092,324 L265F probably damaging Het
Cacna1s A G 1: 136,071,048 Y227C probably damaging Het
Cacna2d2 G A 9: 107,525,376 A848T probably benign Het
Cep135 T C 5: 76,591,873 probably null Het
Cyp2b9 G T 7: 26,186,686 E93* probably null Het
Dcp2 C A 18: 44,400,348 S122* probably null Het
Ecel1 A G 1: 87,152,023 L456P probably damaging Het
Entpd8 T C 2: 25,085,016 M453T probably damaging Het
Gcc2 T A 10: 58,278,881 V1084D probably damaging Het
Grem1 A G 2: 113,749,833 C108R probably damaging Het
Gtf2ird1 T C 5: 134,363,215 E880G probably benign Het
Hacd2 T A 16: 35,102,107 M222K probably damaging Het
Htr1b G T 9: 81,632,599 probably null Het
Htt T G 5: 34,852,287 probably null Het
Ifnab T G 4: 88,690,896 D111A probably benign Het
Igsf10 A T 3: 59,319,632 L2207I probably benign Het
Itln1 T C 1: 171,530,598 Y194C probably damaging Het
Kmt5b T A 19: 3,815,043 D702E probably damaging Het
Knop1 T C 7: 118,850,637 E382G unknown Het
Lrit3 A C 3: 129,800,803 L42V probably damaging Het
Olfr1436 T C 19: 12,298,632 M167V probably benign Het
Olfr281 G A 15: 98,457,068 G253R probably damaging Het
Olfr945 A T 9: 39,258,222 I150N possibly damaging Het
Papln A T 12: 83,780,662 E758V probably damaging Het
Pcnx3 A C 19: 5,678,932 F967V possibly damaging Het
Pcnx4 G T 12: 72,556,068 C368F probably benign Het
Pi15 T A 1: 17,602,881 Y101* probably null Het
Ppp1r9a G A 6: 4,905,894 V150M possibly damaging Het
Prrt4 A T 6: 29,176,901 probably null Het
Ptgdr A G 14: 44,853,371 V310A probably benign Het
Ric1 G A 19: 29,594,893 S696N probably benign Het
Setx T A 2: 29,147,418 V1305D probably damaging Het
Slk G A 19: 47,622,357 R822H probably damaging Het
Tas2r135 T A 6: 42,406,138 F204I probably benign Het
Tcaf3 A T 6: 42,594,206 probably null Het
Tmtc2 A G 10: 105,573,707 Y15H probably benign Het
Treml2 T C 17: 48,308,140 S218P probably benign Het
Tubb2a T C 13: 34,074,571 E412G probably damaging Het
Usp48 T G 4: 137,605,749 probably null Het
Vmn2r25 A T 6: 123,828,472 N475K probably damaging Het
Zscan4-ps1 G A 7: 11,065,808 H385Y probably benign Het
Other mutations in Mug2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00708:Mug2 APN 6 122047487 missense possibly damaging 0.83
IGL00957:Mug2 APN 6 122040654 missense probably damaging 0.99
IGL01314:Mug2 APN 6 122081279 missense possibly damaging 0.62
IGL01338:Mug2 APN 6 122049628 splice site probably benign
IGL01477:Mug2 APN 6 122081684 splice site probably benign
IGL01926:Mug2 APN 6 122036104 splice site probably benign
IGL02019:Mug2 APN 6 122047435 missense probably benign 0.02
IGL02305:Mug2 APN 6 122036056 missense probably benign
IGL02310:Mug2 APN 6 122059123 splice site probably benign
IGL02484:Mug2 APN 6 122072753 missense probably damaging 1.00
IGL02516:Mug2 APN 6 122070843 missense probably damaging 1.00
IGL02531:Mug2 APN 6 122072771 missense probably damaging 1.00
IGL02666:Mug2 APN 6 122081326 missense probably damaging 1.00
IGL02936:Mug2 APN 6 122081387 critical splice donor site probably null
R0114:Mug2 UTSW 6 122040648 missense probably damaging 1.00
R0119:Mug2 UTSW 6 122036063 missense probably benign 0.00
R0123:Mug2 UTSW 6 122074714 missense possibly damaging 0.89
R0144:Mug2 UTSW 6 122071011 splice site probably benign
R0225:Mug2 UTSW 6 122074714 missense possibly damaging 0.89
R0514:Mug2 UTSW 6 122081599 missense probably damaging 1.00
R0763:Mug2 UTSW 6 122075294 missense probably benign
R0959:Mug2 UTSW 6 122085495 missense probably benign 0.33
R1104:Mug2 UTSW 6 122059055 missense probably benign
R1239:Mug2 UTSW 6 122081678 splice site probably benign
R1318:Mug2 UTSW 6 122077402 missense probably damaging 1.00
R1460:Mug2 UTSW 6 122040533 splice site probably benign
R1706:Mug2 UTSW 6 122036232 splice site probably benign
R1761:Mug2 UTSW 6 122074705 missense probably benign 0.20
R1901:Mug2 UTSW 6 122071842 missense probably benign 0.02
R1913:Mug2 UTSW 6 122070870 missense probably damaging 1.00
R1943:Mug2 UTSW 6 122079639 missense probably benign
R2054:Mug2 UTSW 6 122077492 missense probably damaging 1.00
R2060:Mug2 UTSW 6 122079612 missense probably benign
R2420:Mug2 UTSW 6 122083460 missense probably damaging 1.00
R2432:Mug2 UTSW 6 122084376 missense possibly damaging 0.93
R2916:Mug2 UTSW 6 122074724 splice site probably null
R2918:Mug2 UTSW 6 122074724 splice site probably null
R3423:Mug2 UTSW 6 122047506 splice site probably benign
R3834:Mug2 UTSW 6 122049787 critical splice donor site probably null
R3902:Mug2 UTSW 6 122075567 missense probably damaging 1.00
R3941:Mug2 UTSW 6 122063563 missense probably benign
R4227:Mug2 UTSW 6 122040732 missense probably benign 0.10
R4284:Mug2 UTSW 6 122063673 missense probably benign 0.00
R4287:Mug2 UTSW 6 122063673 missense probably benign 0.00
R4377:Mug2 UTSW 6 122071007 critical splice donor site probably null
R4419:Mug2 UTSW 6 122079630 missense probably damaging 1.00
R4498:Mug2 UTSW 6 122082752 missense probably damaging 0.99
R4566:Mug2 UTSW 6 122079638 missense probably benign 0.00
R4690:Mug2 UTSW 6 122036296 missense probably benign
R4732:Mug2 UTSW 6 122071872 missense probably damaging 0.99
R4733:Mug2 UTSW 6 122071872 missense probably damaging 0.99
R4741:Mug2 UTSW 6 122079613 missense probably benign
R4888:Mug2 UTSW 6 122081195 missense probably damaging 1.00
R5199:Mug2 UTSW 6 122040660 missense probably benign
R5347:Mug2 UTSW 6 122081592 missense probably damaging 1.00
R5457:Mug2 UTSW 6 122049729 nonsense probably null
R5495:Mug2 UTSW 6 122079650 missense probably damaging 0.96
R5509:Mug2 UTSW 6 122084381 missense possibly damaging 0.84
R6006:Mug2 UTSW 6 122083500 missense probably null 0.98
R6180:Mug2 UTSW 6 122079606 missense probably benign 0.01
R6184:Mug2 UTSW 6 122037046 missense probably benign
R6199:Mug2 UTSW 6 122047439 missense probably benign 0.05
R6262:Mug2 UTSW 6 122075255 missense probably damaging 1.00
R6416:Mug2 UTSW 6 122082754 missense probably damaging 1.00
R6548:Mug2 UTSW 6 122047442 missense probably damaging 1.00
R6703:Mug2 UTSW 6 122078694 missense probably benign 0.25
R7106:Mug2 UTSW 6 122082721 missense probably damaging 1.00
R7131:Mug2 UTSW 6 122075247 missense probably damaging 1.00
R7372:Mug2 UTSW 6 122083466 missense possibly damaging 0.88
R7379:Mug2 UTSW 6 122047487 missense possibly damaging 0.83
R7419:Mug2 UTSW 6 122040570 missense possibly damaging 0.86
R7423:Mug2 UTSW 6 122079726 missense probably benign 0.00
R7581:Mug2 UTSW 6 122063711 missense probably damaging 1.00
R7582:Mug2 UTSW 6 122079644 missense probably damaging 0.99
R7672:Mug2 UTSW 6 122040719 missense probably benign 0.37
R7713:Mug2 UTSW 6 122078795 missense possibly damaging 0.83
R7759:Mug2 UTSW 6 122081358 missense probably damaging 1.00
R7834:Mug2 UTSW 6 122036282 missense probably benign
R8029:Mug2 UTSW 6 122081545 critical splice acceptor site probably null
R8127:Mug2 UTSW 6 122075608 missense probably benign 0.01
R8335:Mug2 UTSW 6 122040584 missense probably benign
R8348:Mug2 UTSW 6 122072233 nonsense probably null
R8557:Mug2 UTSW 6 122063701 missense probably damaging 0.99
R8798:Mug2 UTSW 6 122081610 missense probably damaging 1.00
R8823:Mug2 UTSW 6 122063689 missense possibly damaging 0.89
Z1177:Mug2 UTSW 6 122037121 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCCATCACTGAAAAGGCATTC -3'
(R):5'- ACCCCATTTCTAGACATTTCTGGAG -3'

Sequencing Primer
(F):5'- TTTCAAATGCTATCCTGAAAGGCCC -3'
(R):5'- CATTTCTAGACATTTCTGGAGTGAAC -3'
Posted On2019-12-20