Mutagenetix > Incidental Mutations

Incidental Mutation 'R7850:Treml2'

606898

Institutional Source

Beutler Lab

Gene Symbol

Treml2

Ensembl Gene

ENSMUSG00000071068

Gene Name

triggering receptor expressed on myeloid cells-like 2

Synonyms

LOC328833

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.068) question?

Stock #

R7850 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

48300038-48312534 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 48308140 bp

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 218 (S218P)

Ref Sequence

ENSEMBL: ENSMUSP00000128215 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000170941]

Predicted Effect

probably benign
Transcript: ENSMUST00000170941
AA Change: S218P

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)

SMART Domains

Protein: ENSMUSP00000128215
Gene: ENSMUSG00000071068
AA Change: S218P

Domain	Start	End	E-Value	Type
signal peptide	1	24	N/A	INTRINSIC
IG	31	129	3.13e-5	SMART
low complexity region	181	199	N/A	INTRINSIC
transmembrane domain	268	290	N/A	INTRINSIC

Meta Mutation Damage Score

0.1357

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 98.9%

Validation Efficiency

100% (43/43)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] TREML2 is located in a gene cluster on chromosome 6 with the single Ig variable (IgV) domain activating receptors TREM1 (MIM 605085) and TREM2 (MIM 605086), but it has distinct structural and functional properties (Allcock et al., 2003 [PubMed 12645956]).[supplied by OMIM, Mar 2008]

Allele List at MGI

Other mutations in this stock

Total: 46 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A630089N07Rik	A	T	16: 98,068,128	D2E	probably damaging	Het
Abhd16b	G	A	2: 181,493,725	R140H	not run	Het
Acad11	G	T	9: 104,114,529	G588C	probably damaging	Het
Baz2b	C	A	2: 59,936,716	E107D	probably damaging	Het
Bcas1	A	G	2: 170,348,103	S625P	probably damaging	Het
Bdp1	T	A	13: 100,092,324	L265F	probably damaging	Het
Cacna1s	A	G	1: 136,071,048	Y227C	probably damaging	Het
Cacna2d2	G	A	9: 107,525,376	A848T	probably benign	Het
Cep135	T	C	5: 76,591,873		probably null	Het
Cyp2b9	G	T	7: 26,186,686	E93*	probably null	Het
Dcp2	C	A	18: 44,400,348	S122*	probably null	Het
Ecel1	A	G	1: 87,152,023	L456P	probably damaging	Het
Entpd8	T	C	2: 25,085,016	M453T	probably damaging	Het
Gcc2	T	A	10: 58,278,881	V1084D	probably damaging	Het
Grem1	A	G	2: 113,749,833	C108R	probably damaging	Het
Gtf2ird1	T	C	5: 134,363,215	E880G	probably benign	Het
Hacd2	T	A	16: 35,102,107	M222K	probably damaging	Het
Htr1b	G	T	9: 81,632,599		probably null	Het
Htt	T	G	5: 34,852,287		probably null	Het
Ifnab	T	G	4: 88,690,896	D111A	probably benign	Het
Igsf10	A	T	3: 59,319,632	L2207I	probably benign	Het
Itln1	T	C	1: 171,530,598	Y194C	probably damaging	Het
Kmt5b	T	A	19: 3,815,043	D702E	probably damaging	Het
Knop1	T	C	7: 118,850,637	E382G	unknown	Het
Lrit3	A	C	3: 129,800,803	L42V	probably damaging	Het
Mug2	A	G	6: 122,075,211	E976G	probably damaging	Het
Olfr1436	T	C	19: 12,298,632	M167V	probably benign	Het
Olfr281	G	A	15: 98,457,068	G253R	probably damaging	Het
Olfr945	A	T	9: 39,258,222	I150N	possibly damaging	Het
Papln	A	T	12: 83,780,662	E758V	probably damaging	Het
Pcnx3	A	C	19: 5,678,932	F967V	possibly damaging	Het
Pcnx4	G	T	12: 72,556,068	C368F	probably benign	Het
Pi15	T	A	1: 17,602,881	Y101*	probably null	Het
Ppp1r9a	G	A	6: 4,905,894	V150M	possibly damaging	Het
Prrt4	A	T	6: 29,176,901		probably null	Het
Ptgdr	A	G	14: 44,853,371	V310A	probably benign	Het
Ric1	G	A	19: 29,594,893	S696N	probably benign	Het
Setx	T	A	2: 29,147,418	V1305D	probably damaging	Het
Slk	G	A	19: 47,622,357	R822H	probably damaging	Het
Tas2r135	T	A	6: 42,406,138	F204I	probably benign	Het
Tcaf3	A	T	6: 42,594,206		probably null	Het
Tmtc2	A	G	10: 105,573,707	Y15H	probably benign	Het
Tubb2a	T	C	13: 34,074,571	E412G	probably damaging	Het
Usp48	T	G	4: 137,605,749		probably null	Het
Vmn2r25	A	T	6: 123,828,472	N475K	probably damaging	Het
Zscan4-ps1	G	A	7: 11,065,808	H385Y	probably benign	Het

Other mutations in Treml2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01767:Treml2	APN	17	48302810	missense	probably benign
IGL02797:Treml2	APN	17	48302711	missense	possibly damaging	0.73
poplar	UTSW	17	48302734	nonsense	probably null
R0105:Treml2	UTSW	17	48302828	missense	probably damaging	0.99
R0105:Treml2	UTSW	17	48302828	missense	probably damaging	0.99
R0670:Treml2	UTSW	17	48307836	splice site	probably null
R1538:Treml2	UTSW	17	48302758	missense	possibly damaging	0.77
R1796:Treml2	UTSW	17	48309502	makesense	probably null
R4396:Treml2	UTSW	17	48308114	missense	probably benign	0.00
R4679:Treml2	UTSW	17	48308175	missense	probably benign	0.36
R4687:Treml2	UTSW	17	48309397	splice site	probably null
R4801:Treml2	UTSW	17	48309159	missense	probably benign	0.18
R4802:Treml2	UTSW	17	48309159	missense	probably benign	0.18
R5314:Treml2	UTSW	17	48300573	missense	probably damaging	0.99
R6791:Treml2	UTSW	17	48309219	missense	probably benign	0.24
R6818:Treml2	UTSW	17	48302897	missense	probably damaging	1.00
R6958:Treml2	UTSW	17	48308152	missense	probably damaging	1.00
R7250:Treml2	UTSW	17	48309127	missense	probably benign	0.05
R7535:Treml2	UTSW	17	48302819	missense	probably damaging	1.00
R8049:Treml2	UTSW	17	48302734	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- AGTCCATATTTCAGACCCTCACG -3'
(R):5'- AATCCCATTCAGCAACGGGC -3'

Sequencing Primer
(F):5'- GCTCCTTTCACATCTGACGTGAC -3'
(R):5'- TGGTTAGAAGTAAGAGTGACCTC -3'

Posted On

2019-12-20