Incidental Mutation 'R7850:Olfr1436'
ID606902
Institutional Source Beutler Lab
Gene Symbol Olfr1436
Ensembl Gene ENSMUSG00000067513
Gene Nameolfactory receptor 1436
SynonymsGA_x6K02T2RE5P-2634596-2633658, MOR214-2
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.068) question?
Stock #R7850 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location12298183-12299130 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 12298632 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Valine at position 167 (M167V)
Ref Sequence ENSEMBL: ENSMUSP00000085113 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087812]
Predicted Effect probably benign
Transcript: ENSMUST00000087812
AA Change: M167V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000085113
Gene: ENSMUSG00000067513
AA Change: M167V

DomainStartEndE-ValueType
Pfam:7tm_4 35 311 2.4e-54 PFAM
Pfam:7tm_1 45 294 1.3e-19 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (43/43)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A630089N07Rik A T 16: 98,068,128 D2E probably damaging Het
Abhd16b G A 2: 181,493,725 R140H not run Het
Acad11 G T 9: 104,114,529 G588C probably damaging Het
Baz2b C A 2: 59,936,716 E107D probably damaging Het
Bcas1 A G 2: 170,348,103 S625P probably damaging Het
Bdp1 T A 13: 100,092,324 L265F probably damaging Het
Cacna1s A G 1: 136,071,048 Y227C probably damaging Het
Cacna2d2 G A 9: 107,525,376 A848T probably benign Het
Cep135 T C 5: 76,591,873 probably null Het
Cyp2b9 G T 7: 26,186,686 E93* probably null Het
Dcp2 C A 18: 44,400,348 S122* probably null Het
Ecel1 A G 1: 87,152,023 L456P probably damaging Het
Entpd8 T C 2: 25,085,016 M453T probably damaging Het
Gcc2 T A 10: 58,278,881 V1084D probably damaging Het
Grem1 A G 2: 113,749,833 C108R probably damaging Het
Gtf2ird1 T C 5: 134,363,215 E880G probably benign Het
Hacd2 T A 16: 35,102,107 M222K probably damaging Het
Htr1b G T 9: 81,632,599 probably null Het
Htt T G 5: 34,852,287 probably null Het
Ifnab T G 4: 88,690,896 D111A probably benign Het
Igsf10 A T 3: 59,319,632 L2207I probably benign Het
Itln1 T C 1: 171,530,598 Y194C probably damaging Het
Kmt5b T A 19: 3,815,043 D702E probably damaging Het
Knop1 T C 7: 118,850,637 E382G unknown Het
Lrit3 A C 3: 129,800,803 L42V probably damaging Het
Mug2 A G 6: 122,075,211 E976G probably damaging Het
Olfr281 G A 15: 98,457,068 G253R probably damaging Het
Olfr945 A T 9: 39,258,222 I150N possibly damaging Het
Papln A T 12: 83,780,662 E758V probably damaging Het
Pcnx3 A C 19: 5,678,932 F967V possibly damaging Het
Pcnx4 G T 12: 72,556,068 C368F probably benign Het
Pi15 T A 1: 17,602,881 Y101* probably null Het
Ppp1r9a G A 6: 4,905,894 V150M possibly damaging Het
Prrt4 A T 6: 29,176,901 probably null Het
Ptgdr A G 14: 44,853,371 V310A probably benign Het
Ric1 G A 19: 29,594,893 S696N probably benign Het
Setx T A 2: 29,147,418 V1305D probably damaging Het
Slk G A 19: 47,622,357 R822H probably damaging Het
Tas2r135 T A 6: 42,406,138 F204I probably benign Het
Tcaf3 A T 6: 42,594,206 probably null Het
Tmtc2 A G 10: 105,573,707 Y15H probably benign Het
Treml2 T C 17: 48,308,140 S218P probably benign Het
Tubb2a T C 13: 34,074,571 E412G probably damaging Het
Usp48 T G 4: 137,605,749 probably null Het
Vmn2r25 A T 6: 123,828,472 N475K probably damaging Het
Zscan4-ps1 G A 7: 11,065,808 H385Y probably benign Het
Other mutations in Olfr1436
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00975:Olfr1436 APN 19 12298785 missense probably damaging 0.99
IGL02129:Olfr1436 APN 19 12298458 missense probably damaging 1.00
PIT4378001:Olfr1436 UTSW 19 12298712 missense probably damaging 1.00
R0727:Olfr1436 UTSW 19 12299094 missense probably benign 0.03
R1244:Olfr1436 UTSW 19 12298496 missense probably damaging 0.98
R1647:Olfr1436 UTSW 19 12298659 missense probably benign
R1648:Olfr1436 UTSW 19 12298659 missense probably benign
R1837:Olfr1436 UTSW 19 12298376 missense probably damaging 1.00
R1899:Olfr1436 UTSW 19 12298343 missense probably damaging 1.00
R2031:Olfr1436 UTSW 19 12298376 missense probably damaging 1.00
R2305:Olfr1436 UTSW 19 12299087 missense probably benign 0.01
R4624:Olfr1436 UTSW 19 12298983 missense probably benign
R4681:Olfr1436 UTSW 19 12299049 missense probably benign 0.05
R4790:Olfr1436 UTSW 19 12298941 missense possibly damaging 0.60
R4865:Olfr1436 UTSW 19 12298580 missense probably damaging 1.00
R4941:Olfr1436 UTSW 19 12298896 missense possibly damaging 0.95
R5138:Olfr1436 UTSW 19 12298776 missense possibly damaging 0.56
R5161:Olfr1436 UTSW 19 12298789 missense probably damaging 0.99
R5560:Olfr1436 UTSW 19 12298644 nonsense probably null
R5983:Olfr1436 UTSW 19 12299103 missense probably benign 0.00
R6736:Olfr1436 UTSW 19 12298572 nonsense probably null
R6882:Olfr1436 UTSW 19 12298570 missense probably damaging 1.00
R6883:Olfr1436 UTSW 19 12298570 missense probably damaging 1.00
R7465:Olfr1436 UTSW 19 12298437 missense probably benign 0.04
R7500:Olfr1436 UTSW 19 12298677 missense probably damaging 0.98
R7529:Olfr1436 UTSW 19 12298722 missense probably damaging 1.00
R7565:Olfr1436 UTSW 19 12298848 missense probably benign 0.09
R7611:Olfr1436 UTSW 19 12298878 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ATGCCTTGGACCTACCCTTAG -3'
(R):5'- TCCACAATGGGACTGAGTGAATC -3'

Sequencing Primer
(F):5'- GGACCTACCCTTAGCTGAAGTGATC -3'
(R):5'- GAGTGAATCTTGCCTCATGACAGC -3'
Posted On2019-12-20