Incidental Mutation 'R7851:Baz2b'
ID606911
Institutional Source Beutler Lab
Gene Symbol Baz2b
Ensembl Gene ENSMUSG00000026987
Gene Namebromodomain adjacent to zinc finger domain, 2B
SynonymsD2Ertd794e, 5830435C13Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.286) question?
Stock #R7851 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location59899363-60209839 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 59936716 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Aspartic acid at position 107 (E107D)
Ref Sequence ENSEMBL: ENSMUSP00000118981 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090925] [ENSMUST00000112550] [ENSMUST00000153136]
Predicted Effect probably damaging
Transcript: ENSMUST00000090925
AA Change: E873D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000088443
Gene: ENSMUSG00000026987
AA Change: E873D

DomainStartEndE-ValueType
low complexity region 7 46 N/A INTRINSIC
low complexity region 82 97 N/A INTRINSIC
low complexity region 147 162 N/A INTRINSIC
low complexity region 193 244 N/A INTRINSIC
low complexity region 291 308 N/A INTRINSIC
low complexity region 366 385 N/A INTRINSIC
low complexity region 528 540 N/A INTRINSIC
low complexity region 554 614 N/A INTRINSIC
low complexity region 628 637 N/A INTRINSIC
low complexity region 671 685 N/A INTRINSIC
Pfam:MBD 690 742 1e-12 PFAM
low complexity region 759 774 N/A INTRINSIC
coiled coil region 814 975 N/A INTRINSIC
DDT 1004 1069 1.19e-20 SMART
low complexity region 1199 1212 N/A INTRINSIC
low complexity region 1213 1247 N/A INTRINSIC
coiled coil region 1251 1286 N/A INTRINSIC
low complexity region 1320 1337 N/A INTRINSIC
low complexity region 1503 1524 N/A INTRINSIC
low complexity region 1569 1582 N/A INTRINSIC
low complexity region 1585 1605 N/A INTRINSIC
Blast:BROMO 1802 1843 7e-18 BLAST
PHD 1888 1934 1.71e-12 SMART
low complexity region 1942 1964 N/A INTRINSIC
low complexity region 1968 1980 N/A INTRINSIC
BROMO 2013 2121 3.85e-41 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000112550
AA Change: E873D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000108169
Gene: ENSMUSG00000026987
AA Change: E873D

DomainStartEndE-ValueType
low complexity region 7 46 N/A INTRINSIC
low complexity region 82 97 N/A INTRINSIC
low complexity region 147 162 N/A INTRINSIC
low complexity region 193 244 N/A INTRINSIC
low complexity region 291 308 N/A INTRINSIC
low complexity region 366 385 N/A INTRINSIC
low complexity region 528 540 N/A INTRINSIC
low complexity region 554 614 N/A INTRINSIC
low complexity region 628 637 N/A INTRINSIC
low complexity region 671 685 N/A INTRINSIC
Pfam:MBD 690 741 3.4e-13 PFAM
low complexity region 759 774 N/A INTRINSIC
coiled coil region 814 975 N/A INTRINSIC
DDT 1004 1069 1.19e-20 SMART
low complexity region 1199 1212 N/A INTRINSIC
low complexity region 1213 1247 N/A INTRINSIC
coiled coil region 1251 1286 N/A INTRINSIC
low complexity region 1320 1337 N/A INTRINSIC
low complexity region 1503 1524 N/A INTRINSIC
low complexity region 1569 1582 N/A INTRINSIC
low complexity region 1585 1605 N/A INTRINSIC
Pfam:WHIM3 1638 1676 5.1e-14 PFAM
Blast:BROMO 1802 1843 7e-18 BLAST
PHD 1888 1934 1.71e-12 SMART
low complexity region 1942 1964 N/A INTRINSIC
low complexity region 1968 1980 N/A INTRINSIC
BROMO 2013 2121 3.85e-41 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000153136
AA Change: E107D

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000118981
Gene: ENSMUSG00000026987
AA Change: E107D

DomainStartEndE-ValueType
coiled coil region 48 218 N/A INTRINSIC
Pfam:DDT 247 296 1.6e-13 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (62/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the bromodomain gene family. Members of this gene family encode proteins that are integral components of chromatin remodeling complexes. The encoded protein showed strong preference for the activating H3K14Ac mark in a histone peptide screen, suggesting a potential role in transcriptional activation. This gene may be associated with susceptibility to sudden cardiac death (SCD). [provided by RefSeq, Aug 2016]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aarsd1 T A 11: 101,410,012 probably null Het
Abcc3 A T 11: 94,359,660 L905* probably null Het
Adamts9 T G 6: 92,908,706 D401A probably damaging Het
Ankmy1 T C 1: 92,871,722 K918E probably damaging Het
Arfgef3 T C 10: 18,592,286 N1722S probably damaging Het
Arhgef18 A G 8: 3,448,409 I481V possibly damaging Het
Asxl3 T C 18: 22,517,222 I756T possibly damaging Het
Atp6v0b A G 4: 117,885,865 F49S probably damaging Het
Calcoco2 GGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCC GGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCC 11: 96,099,982 probably benign Het
Cd2ap A G 17: 42,824,472 probably null Het
Cnn3 T A 3: 121,457,343 Y304N possibly damaging Het
Cnot2 G A 10: 116,537,432 S22L possibly damaging Het
Coq6 A T 12: 84,372,155 H311L possibly damaging Het
Csf2rb2 T C 15: 78,288,937 N350S probably benign Het
Dhrs9 T A 2: 69,401,256 N253K probably benign Het
Dok7 T A 5: 35,056,936 M1K probably null Het
Eogt T A 6: 97,120,201 E313D probably benign Het
Etl4 T C 2: 20,744,140 S430P probably damaging Het
Gfod2 T A 8: 105,728,130 E39D probably benign Het
Gfral T C 9: 76,205,455 N65D probably benign Het
Gsdmc4 A T 15: 63,902,746 L62* probably null Het
Gyg T G 3: 20,122,747 M360L probably benign Het
Hsp90ab1 A T 17: 45,570,452 S255T probably benign Het
Hyal6 T A 6: 24,734,498 D143E probably benign Het
Ipp C T 4: 116,515,475 Q234* probably null Het
Ism1 A T 2: 139,757,265 D386V probably damaging Het
Jrkl T C 9: 13,244,349 T436A probably benign Het
Mup3 A C 4: 62,085,257 I125S possibly damaging Het
Myh6 T A 14: 54,953,051 E1003V possibly damaging Het
Neb T A 2: 52,153,064 I6785F probably benign Het
Olfr225 T C 11: 59,613,963 V333A probably benign Het
Olfr350 T A 2: 36,850,416 Y123* probably null Het
Olfr739 A G 14: 50,425,370 T284A probably damaging Het
Olfr747 A G 14: 50,681,458 Y59H probably damaging Het
Olfr787 G T 10: 129,463,560 V295L probably benign Het
Pamr1 A T 2: 102,586,600 T86S probably benign Het
Pced1a A T 2: 130,422,316 M168K probably damaging Het
Pigs T C 11: 78,336,787 L259P probably damaging Het
Plch1 T C 3: 63,698,434 S1350G probably damaging Het
Prickle1 G A 15: 93,500,559 T796I possibly damaging Het
Ptcd3 T C 6: 71,902,859 I138M probably damaging Het
Ptprs T C 17: 56,425,482 E958G probably benign Het
Rcn3 A T 7: 45,086,812 D157E probably benign Het
Rft1 T C 14: 30,690,583 S534P probably benign Het
Ryr3 T C 2: 112,678,517 T3371A probably benign Het
Scn10a A T 9: 119,617,762 V1399D probably damaging Het
Sec61a1 T C 6: 88,512,165 T185A probably benign Het
Sgsm3 G A 15: 81,010,753 V607M probably damaging Het
Smurf2 T C 11: 106,830,926 Y581C probably damaging Het
Snx8 C A 5: 140,358,159 V101L probably damaging Het
Sp100 A T 1: 85,706,926 K180M probably benign Het
Spire2 T A 8: 123,356,699 probably null Het
St6galnac2 A G 11: 116,685,938 S86P probably benign Het
Sybu G A 15: 44,746,456 Q139* probably null Het
Tas2r114 T A 6: 131,689,925 I47F probably damaging Het
Tcf21 T C 10: 22,819,848 D19G probably benign Het
Terb2 T C 2: 122,186,313 F9L probably damaging Het
Tlr1 T C 5: 64,924,964 T757A possibly damaging Het
Tmco1 C T 1: 167,308,686 probably benign Het
Tshz3 T C 7: 36,771,589 F1001S probably damaging Het
Ttc25 C T 11: 100,545,829 T10I probably damaging Het
Vmn2r62 G A 7: 42,789,115 T99I probably benign Het
Wdr7 A T 18: 63,720,327 T33S probably benign Het
Other mutations in Baz2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00430:Baz2b APN 2 59912795 missense probably benign 0.02
IGL00476:Baz2b APN 2 59913739 missense probably benign 0.06
IGL00489:Baz2b APN 2 59957675 nonsense probably null
IGL00514:Baz2b APN 2 59962477 missense probably benign 0.11
IGL00678:Baz2b APN 2 60006183 missense unknown
IGL01348:Baz2b APN 2 59933687 missense possibly damaging 0.95
IGL01354:Baz2b APN 2 59968889 missense probably benign 0.18
IGL01924:Baz2b APN 2 59935271 missense probably damaging 1.00
IGL02125:Baz2b APN 2 59968640 missense probably benign 0.12
IGL02314:Baz2b APN 2 59962227 missense probably benign
IGL02370:Baz2b APN 2 59923589 missense possibly damaging 0.77
IGL02473:Baz2b APN 2 59960063 missense probably benign 0.40
IGL02499:Baz2b APN 2 59901496 missense possibly damaging 0.60
IGL02609:Baz2b APN 2 59917369 missense possibly damaging 0.77
IGL02705:Baz2b APN 2 59948260 missense possibly damaging 0.92
IGL02711:Baz2b APN 2 59917505 unclassified probably benign
IGL02716:Baz2b APN 2 59962524 missense possibly damaging 0.53
IGL02724:Baz2b APN 2 59977374 missense possibly damaging 0.70
IGL02750:Baz2b APN 2 59968658 missense possibly damaging 0.73
IGL02869:Baz2b APN 2 59977528 missense probably benign 0.00
IGL02886:Baz2b APN 2 59957743 splice site probably null
IGL02892:Baz2b APN 2 59900736 missense probably damaging 1.00
IGL03132:Baz2b APN 2 59907753 splice site probably benign
IGL03183:Baz2b APN 2 59903296 missense probably benign 0.10
IGL03197:Baz2b APN 2 59901554 missense possibly damaging 0.74
R0054:Baz2b UTSW 2 59932166 missense probably damaging 1.00
R0054:Baz2b UTSW 2 59932166 missense probably damaging 1.00
R0122:Baz2b UTSW 2 59913619 splice site probably null
R0136:Baz2b UTSW 2 59901954 missense probably benign 0.22
R0144:Baz2b UTSW 2 59907495 missense probably damaging 0.98
R0403:Baz2b UTSW 2 59969377 missense possibly damaging 0.70
R0498:Baz2b UTSW 2 59901996 unclassified probably benign
R0528:Baz2b UTSW 2 59936739 missense probably damaging 1.00
R1025:Baz2b UTSW 2 59962482 missense probably benign 0.06
R1470:Baz2b UTSW 2 59978546 missense possibly damaging 0.53
R1470:Baz2b UTSW 2 59978546 missense possibly damaging 0.53
R1510:Baz2b UTSW 2 59922209 missense probably damaging 1.00
R1511:Baz2b UTSW 2 59962024 missense probably benign 0.12
R1514:Baz2b UTSW 2 59962326 missense probably benign 0.13
R1519:Baz2b UTSW 2 59948254 missense possibly damaging 0.50
R1523:Baz2b UTSW 2 59968637 missense possibly damaging 0.47
R1630:Baz2b UTSW 2 60006130 missense unknown
R1641:Baz2b UTSW 2 59912890 missense probably damaging 0.99
R1674:Baz2b UTSW 2 59912992 missense possibly damaging 0.53
R1778:Baz2b UTSW 2 60006136 missense unknown
R1826:Baz2b UTSW 2 59968733 missense probably benign 0.12
R1835:Baz2b UTSW 2 59901819 missense probably benign 0.02
R1954:Baz2b UTSW 2 59968743 missense probably benign 0.12
R1981:Baz2b UTSW 2 59923680 missense possibly damaging 0.95
R2029:Baz2b UTSW 2 59912723 unclassified probably benign
R2567:Baz2b UTSW 2 59913911 missense possibly damaging 0.82
R2842:Baz2b UTSW 2 59913004 missense probably benign 0.27
R2848:Baz2b UTSW 2 59924666 missense possibly damaging 0.64
R3809:Baz2b UTSW 2 59968896 missense probably benign 0.12
R3935:Baz2b UTSW 2 59912761 missense possibly damaging 0.81
R3936:Baz2b UTSW 2 59912761 missense possibly damaging 0.81
R4072:Baz2b UTSW 2 59912573 splice site probably null
R4182:Baz2b UTSW 2 60098457 intron probably benign
R4255:Baz2b UTSW 2 59920572 unclassified probably benign
R4359:Baz2b UTSW 2 59901613 missense possibly damaging 0.87
R4716:Baz2b UTSW 2 59969255 missense probably benign 0.06
R4743:Baz2b UTSW 2 59913911 missense probably benign 0.01
R4772:Baz2b UTSW 2 59958451 missense probably damaging 0.96
R4858:Baz2b UTSW 2 59907743 missense probably benign
R4868:Baz2b UTSW 2 59924882 missense possibly damaging 0.65
R4872:Baz2b UTSW 2 59942759 splice site probably null
R4889:Baz2b UTSW 2 59936726 missense probably damaging 1.00
R4890:Baz2b UTSW 2 59926039 missense probably damaging 0.99
R4914:Baz2b UTSW 2 59914043 missense possibly damaging 0.70
R4915:Baz2b UTSW 2 59914043 missense possibly damaging 0.70
R4918:Baz2b UTSW 2 59914043 missense possibly damaging 0.70
R5027:Baz2b UTSW 2 60098644 intron probably benign
R5031:Baz2b UTSW 2 59912807 missense probably benign 0.00
R5082:Baz2b UTSW 2 59901491 nonsense probably null
R5133:Baz2b UTSW 2 59962024 missense probably benign 0.12
R5276:Baz2b UTSW 2 59962614 missense probably benign 0.40
R5279:Baz2b UTSW 2 59932152 missense probably damaging 1.00
R5294:Baz2b UTSW 2 59978602 missense probably benign 0.11
R5447:Baz2b UTSW 2 59913988 missense probably damaging 0.99
R5903:Baz2b UTSW 2 59959889 missense probably damaging 0.99
R5910:Baz2b UTSW 2 59977426 missense possibly damaging 0.88
R6140:Baz2b UTSW 2 59912527 missense probably damaging 0.99
R6195:Baz2b UTSW 2 59907511 missense possibly damaging 0.89
R6199:Baz2b UTSW 2 59978675 missense probably benign 0.00
R6208:Baz2b UTSW 2 59924806 missense probably damaging 1.00
R6233:Baz2b UTSW 2 59907511 missense possibly damaging 0.89
R6276:Baz2b UTSW 2 59948223 missense probably damaging 1.00
R6324:Baz2b UTSW 2 59906948 missense probably damaging 1.00
R6490:Baz2b UTSW 2 59901729 missense probably damaging 1.00
R6578:Baz2b UTSW 2 59969279 missense possibly damaging 0.47
R6720:Baz2b UTSW 2 59924890 missense probably damaging 1.00
R6760:Baz2b UTSW 2 59962432 missense probably benign 0.40
R6836:Baz2b UTSW 2 59917425 missense probably damaging 1.00
R6859:Baz2b UTSW 2 59901530 missense probably benign 0.01
R6880:Baz2b UTSW 2 59912939 missense probably damaging 0.99
R6916:Baz2b UTSW 2 59968776 missense probably benign
R6978:Baz2b UTSW 2 59907715 missense possibly damaging 0.84
R7037:Baz2b UTSW 2 59933670 critical splice donor site probably null
R7112:Baz2b UTSW 2 59962184 missense possibly damaging 0.53
R7117:Baz2b UTSW 2 59912497 missense
R7198:Baz2b UTSW 2 59962206 missense probably benign 0.00
R7270:Baz2b UTSW 2 59962492 missense possibly damaging 0.96
R7282:Baz2b UTSW 2 59920437 missense probably benign 0.17
R7464:Baz2b UTSW 2 59977448 missense possibly damaging 0.53
R7609:Baz2b UTSW 2 59962473 missense probably benign 0.40
R7703:Baz2b UTSW 2 59917425 missense probably damaging 1.00
R7850:Baz2b UTSW 2 59936716 missense probably damaging 0.98
R7988:Baz2b UTSW 2 59962141 missense possibly damaging 0.53
R8079:Baz2b UTSW 2 59900768 missense probably damaging 1.00
R8084:Baz2b UTSW 2 59962236 missense probably benign
R8343:Baz2b UTSW 2 59901514 missense probably damaging 1.00
R8348:Baz2b UTSW 2 59911793 missense
R8438:Baz2b UTSW 2 59917484 nonsense probably null
R8448:Baz2b UTSW 2 59911793 missense
R8511:Baz2b UTSW 2 59901814 missense probably benign
X0011:Baz2b UTSW 2 59977361 missense possibly damaging 0.53
X0053:Baz2b UTSW 2 59900675 missense probably damaging 1.00
X0064:Baz2b UTSW 2 59969282 missense probably benign
Z1088:Baz2b UTSW 2 59960015 missense probably damaging 1.00
Z1177:Baz2b UTSW 2 59977520 missense probably benign 0.01
Z1188:Baz2b UTSW 2 59977405 missense probably benign
Predicted Primers PCR Primer
(F):5'- AACGTACTGAGCAGCTTCG -3'
(R):5'- GCTGACAAAGGCATGTATATGAATG -3'

Sequencing Primer
(F):5'- CTTCGGAGCCCAACCCG -3'
(R):5'- GTACAAGTTCAGTAAGTGGTAGTAAC -3'
Posted On2019-12-20