Incidental Mutation 'R7851:Cnn3'
ID606920
Institutional Source Beutler Lab
Gene Symbol Cnn3
Ensembl Gene ENSMUSG00000053931
Gene Namecalponin 3, acidic
SynonymsCalpo3, 1600014M03Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.224) question?
Stock #R7851 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location121426497-121458207 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 121457343 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Asparagine at position 304 (Y304N)
Ref Sequence ENSEMBL: ENSMUSP00000029773 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029773] [ENSMUST00000039197] [ENSMUST00000197135] [ENSMUST00000198393]
Predicted Effect possibly damaging
Transcript: ENSMUST00000029773
AA Change: Y304N

PolyPhen 2 Score 0.852 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000029773
Gene: ENSMUSG00000053931
AA Change: Y304N

DomainStartEndE-ValueType
CH 28 125 3.92e-27 SMART
Pfam:Calponin 164 188 1.1e-19 PFAM
Pfam:Calponin 204 228 7.4e-17 PFAM
Pfam:Calponin 243 267 1.8e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000039197
SMART Domains Protein: ENSMUSP00000040210
Gene: ENSMUSG00000039865

DomainStartEndE-ValueType
transmembrane domain 37 59 N/A INTRINSIC
transmembrane domain 217 239 N/A INTRINSIC
transmembrane domain 244 266 N/A INTRINSIC
Pfam:Choline_transpo 291 607 2.3e-80 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000197135
AA Change: Y258N

PolyPhen 2 Score 0.824 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000142526
Gene: ENSMUSG00000053931
AA Change: Y258N

DomainStartEndE-ValueType
CH 28 120 8.6e-10 SMART
Pfam:Calponin 158 183 1e-10 PFAM
Pfam:Calponin 197 222 9.6e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000198393
SMART Domains Protein: ENSMUSP00000143186
Gene: ENSMUSG00000053931

DomainStartEndE-ValueType
Blast:CH 1 28 7e-12 BLAST
SCOP:d1h67a_ 1 35 9e-9 SMART
PDB:1WYN|A 1 53 3e-21 PDB
Pfam:Calponin 67 92 1.2e-14 PFAM
Pfam:Calponin 107 132 3.8e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000198620
Predicted Effect probably benign
Transcript: ENSMUST00000199499
Meta Mutation Damage Score 0.3106 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (62/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with a markedly acidic C terminus; the basic N-terminus is highly homologous to the N-terminus of a related gene, CNN1. Members of the CNN gene family all contain similar tandemly repeated motifs. This encoded protein is associated with the cytoskeleton but is not involved in contraction. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit severe exencephaly, neuronal tissue overgrowth and die immediately postnatal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aarsd1 T A 11: 101,410,012 probably null Het
Abcc3 A T 11: 94,359,660 L905* probably null Het
Adamts9 T G 6: 92,908,706 D401A probably damaging Het
Ankmy1 T C 1: 92,871,722 K918E probably damaging Het
Arfgef3 T C 10: 18,592,286 N1722S probably damaging Het
Arhgef18 A G 8: 3,448,409 I481V possibly damaging Het
Asxl3 T C 18: 22,517,222 I756T possibly damaging Het
Atp6v0b A G 4: 117,885,865 F49S probably damaging Het
Baz2b C A 2: 59,936,716 E107D probably damaging Het
Calcoco2 GGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCC GGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCC 11: 96,099,982 probably benign Het
Cd2ap A G 17: 42,824,472 probably null Het
Cnot2 G A 10: 116,537,432 S22L possibly damaging Het
Coq6 A T 12: 84,372,155 H311L possibly damaging Het
Csf2rb2 T C 15: 78,288,937 N350S probably benign Het
Dhrs9 T A 2: 69,401,256 N253K probably benign Het
Dok7 T A 5: 35,056,936 M1K probably null Het
Eogt T A 6: 97,120,201 E313D probably benign Het
Etl4 T C 2: 20,744,140 S430P probably damaging Het
Gfod2 T A 8: 105,728,130 E39D probably benign Het
Gfral T C 9: 76,205,455 N65D probably benign Het
Gsdmc4 A T 15: 63,902,746 L62* probably null Het
Gyg T G 3: 20,122,747 M360L probably benign Het
Hsp90ab1 A T 17: 45,570,452 S255T probably benign Het
Hyal6 T A 6: 24,734,498 D143E probably benign Het
Ipp C T 4: 116,515,475 Q234* probably null Het
Ism1 A T 2: 139,757,265 D386V probably damaging Het
Jrkl T C 9: 13,244,349 T436A probably benign Het
Mup3 A C 4: 62,085,257 I125S possibly damaging Het
Myh6 T A 14: 54,953,051 E1003V possibly damaging Het
Neb T A 2: 52,153,064 I6785F probably benign Het
Olfr225 T C 11: 59,613,963 V333A probably benign Het
Olfr350 T A 2: 36,850,416 Y123* probably null Het
Olfr739 A G 14: 50,425,370 T284A probably damaging Het
Olfr747 A G 14: 50,681,458 Y59H probably damaging Het
Olfr787 G T 10: 129,463,560 V295L probably benign Het
Pamr1 A T 2: 102,586,600 T86S probably benign Het
Pced1a A T 2: 130,422,316 M168K probably damaging Het
Pigs T C 11: 78,336,787 L259P probably damaging Het
Plch1 T C 3: 63,698,434 S1350G probably damaging Het
Prickle1 G A 15: 93,500,559 T796I possibly damaging Het
Ptcd3 T C 6: 71,902,859 I138M probably damaging Het
Ptprs T C 17: 56,425,482 E958G probably benign Het
Rcn3 A T 7: 45,086,812 D157E probably benign Het
Rft1 T C 14: 30,690,583 S534P probably benign Het
Ryr3 T C 2: 112,678,517 T3371A probably benign Het
Scn10a A T 9: 119,617,762 V1399D probably damaging Het
Sec61a1 T C 6: 88,512,165 T185A probably benign Het
Sgsm3 G A 15: 81,010,753 V607M probably damaging Het
Smurf2 T C 11: 106,830,926 Y581C probably damaging Het
Snx8 C A 5: 140,358,159 V101L probably damaging Het
Sp100 A T 1: 85,706,926 K180M probably benign Het
Spire2 T A 8: 123,356,699 probably null Het
St6galnac2 A G 11: 116,685,938 S86P probably benign Het
Sybu G A 15: 44,746,456 Q139* probably null Het
Tas2r114 T A 6: 131,689,925 I47F probably damaging Het
Tcf21 T C 10: 22,819,848 D19G probably benign Het
Terb2 T C 2: 122,186,313 F9L probably damaging Het
Tlr1 T C 5: 64,924,964 T757A possibly damaging Het
Tmco1 C T 1: 167,308,686 probably benign Het
Tshz3 T C 7: 36,771,589 F1001S probably damaging Het
Ttc25 C T 11: 100,545,829 T10I probably damaging Het
Vmn2r62 G A 7: 42,789,115 T99I probably benign Het
Wdr7 A T 18: 63,720,327 T33S probably benign Het
Other mutations in Cnn3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02900:Cnn3 APN 3 121451494 missense probably benign 0.03
BB009:Cnn3 UTSW 3 121451429 missense probably benign 0.15
BB019:Cnn3 UTSW 3 121451429 missense probably benign 0.15
R0711:Cnn3 UTSW 3 121449984 missense probably benign 0.00
R0811:Cnn3 UTSW 3 121454951 missense probably damaging 1.00
R0812:Cnn3 UTSW 3 121454951 missense probably damaging 1.00
R1368:Cnn3 UTSW 3 121457137 missense probably benign 0.01
R1567:Cnn3 UTSW 3 121449958 nonsense probably null
R1675:Cnn3 UTSW 3 121457169 nonsense probably null
R2132:Cnn3 UTSW 3 121451935 missense probably damaging 0.97
R2851:Cnn3 UTSW 3 121450053 start gained probably benign
R5850:Cnn3 UTSW 3 121451928 missense probably damaging 0.99
R6936:Cnn3 UTSW 3 121450053 start gained probably benign
R7196:Cnn3 UTSW 3 121454788 splice site probably null
R7866:Cnn3 UTSW 3 121451393 missense probably benign 0.16
R7867:Cnn3 UTSW 3 121455055 missense probably benign 0.27
R7932:Cnn3 UTSW 3 121451429 missense probably benign 0.15
R8139:Cnn3 UTSW 3 121455069 missense probably damaging 1.00
R8320:Cnn3 UTSW 3 121449986 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGCACCAACAAAGTTGCTTC -3'
(R):5'- GCACTAGAAGGCAGCTATTTAGG -3'

Sequencing Primer
(F):5'- TTGCTTCCCAGAAAGGAATGAGC -3'
(R):5'- GGCATACTTTAAAGGTACAACAAGC -3'
Posted On2019-12-20