Incidental Mutation 'R7851:Eogt'
ID606931
Institutional Source Beutler Lab
Gene Symbol Eogt
Ensembl Gene ENSMUSG00000035245
Gene NameEGF domain-specific O-linked N-acetylglucosamine (GlcNAc) transferase
SynonymsA130022J15Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.181) question?
Stock #R7851 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location97110024-97149182 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 97120201 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Aspartic acid at position 313 (E313D)
Ref Sequence ENSEMBL: ENSMUSP00000061610 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054344] [ENSMUST00000113387]
Predicted Effect probably benign
Transcript: ENSMUST00000054344
AA Change: E313D

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000061610
Gene: ENSMUSG00000035245
AA Change: E313D

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:DUF563 245 472 1.3e-31 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113387
SMART Domains Protein: ENSMUSP00000109014
Gene: ENSMUSG00000035245

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an enzyme that acts in the lumen of the endoplasmic reticulum to catalyze the transfer of N-acetylglucosamine to serine or threonine residues of extracellular-targeted proteins. This enzyme modifies proteins containing eukaryotic growth factor (EGF)-like domains, including the Notch receptor, thereby regulating developmental signalling. Mutations in this gene have been observed in individuals with Adams-Oliver syndrome 4. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2015]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc3 A T 11: 94,359,660 L905* probably null Het
Adamts9 T G 6: 92,908,706 D401A probably damaging Het
Ankmy1 T C 1: 92,871,722 K918E probably damaging Het
Arfgef3 T C 10: 18,592,286 N1722S probably damaging Het
Arhgef18 A G 8: 3,448,409 I481V possibly damaging Het
Asxl3 T C 18: 22,517,222 I756T possibly damaging Het
Atp6v0b A G 4: 117,885,865 F49S probably damaging Het
Baz2b C A 2: 59,936,716 E107D probably damaging Het
Calcoco2 GGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCC GGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCC 11: 96,099,982 probably benign Het
Cd2ap A G 17: 42,824,472 probably null Het
Cnn3 T A 3: 121,457,343 Y304N possibly damaging Het
Coq6 A T 12: 84,372,155 H311L possibly damaging Het
Csf2rb2 T C 15: 78,288,937 N350S probably benign Het
Dhrs9 T A 2: 69,401,256 N253K probably benign Het
Dok7 T A 5: 35,056,936 M1K probably null Het
Etl4 T C 2: 20,744,140 S430P probably damaging Het
Gfod2 T A 8: 105,728,130 E39D probably benign Het
Gfral T C 9: 76,205,455 N65D probably benign Het
Gsdmc4 A T 15: 63,902,746 L62* probably null Het
Gyg T G 3: 20,122,747 M360L probably benign Het
Hsp90ab1 A T 17: 45,570,452 S255T probably benign Het
Hyal6 T A 6: 24,734,498 D143E probably benign Het
Ipp C T 4: 116,515,475 Q234* probably null Het
Ism1 A T 2: 139,757,265 D386V probably damaging Het
Jrkl T C 9: 13,244,349 T436A probably benign Het
Mup3 A C 4: 62,085,257 I125S possibly damaging Het
Myh6 T A 14: 54,953,051 E1003V possibly damaging Het
Neb T A 2: 52,153,064 I6785F probably benign Het
Olfr225 T C 11: 59,613,963 V333A probably benign Het
Olfr350 T A 2: 36,850,416 Y123* probably null Het
Olfr739 A G 14: 50,425,370 T284A probably damaging Het
Olfr747 A G 14: 50,681,458 Y59H probably damaging Het
Olfr787 G T 10: 129,463,560 V295L probably benign Het
Pamr1 A T 2: 102,586,600 T86S probably benign Het
Pced1a A T 2: 130,422,316 M168K probably damaging Het
Pigs T C 11: 78,336,787 L259P probably damaging Het
Plch1 T C 3: 63,698,434 S1350G probably damaging Het
Prickle1 G A 15: 93,500,559 T796I possibly damaging Het
Ptcd3 T C 6: 71,902,859 I138M probably damaging Het
Ptprs T C 17: 56,425,482 E958G probably benign Het
Rcn3 A T 7: 45,086,812 D157E probably benign Het
Rft1 T C 14: 30,690,583 S534P probably benign Het
Ryr3 T C 2: 112,678,517 T3371A probably benign Het
Scn10a A T 9: 119,617,762 V1399D probably damaging Het
Sec61a1 T C 6: 88,512,165 T185A probably benign Het
Sgsm3 G A 15: 81,010,753 V607M probably damaging Het
Smurf2 T C 11: 106,830,926 Y581C probably damaging Het
Snx8 C A 5: 140,358,159 V101L probably damaging Het
Sp100 A T 1: 85,706,926 K180M probably benign Het
St6galnac2 A G 11: 116,685,938 S86P probably benign Het
Sybu G A 15: 44,746,456 Q139* probably null Het
Tas2r114 T A 6: 131,689,925 I47F probably damaging Het
Tcf21 T C 10: 22,819,848 D19G probably benign Het
Terb2 T C 2: 122,186,313 F9L probably damaging Het
Tlr1 T C 5: 64,924,964 T757A possibly damaging Het
Tmco1 C T 1: 167,308,686 probably benign Het
Tshz3 T C 7: 36,771,589 F1001S probably damaging Het
Ttc25 C T 11: 100,545,829 T10I probably damaging Het
Vmn2r62 G A 7: 42,789,115 T99I probably benign Het
Wdr7 A T 18: 63,720,327 T33S probably benign Het
Other mutations in Eogt
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00911:Eogt APN 6 97120000 missense probably damaging 0.97
IGL01292:Eogt APN 6 97144027 missense possibly damaging 0.88
IGL02332:Eogt APN 6 97125605 missense probably damaging 1.00
IGL02439:Eogt APN 6 97143973 missense possibly damaging 0.83
R0019:Eogt UTSW 6 97134273 unclassified probably benign
R0112:Eogt UTSW 6 97135284 splice site probably benign
R0325:Eogt UTSW 6 97113955 missense probably damaging 0.99
R0497:Eogt UTSW 6 97135233 missense probably benign 0.00
R0730:Eogt UTSW 6 97116009 nonsense probably null
R1730:Eogt UTSW 6 97113864 missense probably damaging 1.00
R1783:Eogt UTSW 6 97113864 missense probably damaging 1.00
R2074:Eogt UTSW 6 97131376 missense probably benign 0.02
R2279:Eogt UTSW 6 97134301 missense probably benign 0.28
R2679:Eogt UTSW 6 97120800 missense probably benign 0.01
R2993:Eogt UTSW 6 97118954 splice site probably null
R3176:Eogt UTSW 6 97131394 missense probably benign 0.21
R3276:Eogt UTSW 6 97131394 missense probably benign 0.21
R3876:Eogt UTSW 6 97120190 missense probably damaging 0.99
R3940:Eogt UTSW 6 97113914 missense probably damaging 1.00
R4613:Eogt UTSW 6 97134304 missense probably benign 0.00
R4704:Eogt UTSW 6 97113852 missense probably damaging 0.99
R4849:Eogt UTSW 6 97116055 missense probably damaging 0.99
R4867:Eogt UTSW 6 97120147 intron probably benign
R4905:Eogt UTSW 6 97142831 missense probably benign 0.01
R5120:Eogt UTSW 6 97134315 missense probably benign
R5143:Eogt UTSW 6 97125584 missense probably damaging 1.00
R5594:Eogt UTSW 6 97116035 missense probably benign 0.01
R6351:Eogt UTSW 6 97120194 missense probably damaging 1.00
R6418:Eogt UTSW 6 97145392 missense possibly damaging 0.77
R6498:Eogt UTSW 6 97135213 missense probably damaging 1.00
R6950:Eogt UTSW 6 97134382 missense possibly damaging 0.77
R7114:Eogt UTSW 6 97116004 missense probably damaging 1.00
R7185:Eogt UTSW 6 97120178 missense probably damaging 1.00
R7221:Eogt UTSW 6 97112724 missense probably damaging 1.00
R7232:Eogt UTSW 6 97119983 missense probably damaging 0.98
R7467:Eogt UTSW 6 97142833 missense probably benign 0.01
R7526:Eogt UTSW 6 97113952 missense probably damaging 1.00
R7672:Eogt UTSW 6 97113909 missense probably damaging 1.00
R7934:Eogt UTSW 6 97120201 missense probably benign 0.01
R8021:Eogt UTSW 6 97134330 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGATGTTCAGCCTATGCAGC -3'
(R):5'- TGTGGTGTCTACCCTATGAAGG -3'

Sequencing Primer
(F):5'- GATGTTCAGCCTATGCAGCACATG -3'
(R):5'- CCTATGAAGGGTGCATACCTTGC -3'
Posted On2019-12-20